GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-01-18 20:04:35, GGGenome : Nematostella vectensis genome, ASM20922v1 (Sep, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NEMVEscaffold_2530 dna:supercontig supercontig:GCA_000209225.1:NEMVEscaffold_2530:1:13726:1
position: 6421-6435
AAGGGCTTTGTTGAACTTGTTCCCATTATT6421TTCATTGACAACATTAGTTGGATTTACTGTATGCAATTTGTTGAA
NEMVEscaffold_68 dna:supercontig supercontig:GCA_000209225.1:NEMVEscaffold_68:1:985182:1
position: 318299-318313
AACAAGGCATTGTCTTAGTTTTAAGGCAAT318299TTCATTGACAACATTCTACAAAAAACGCTTTACTCTTCCCCTCTC
NEMVEscaffold_67 dna:supercontig supercontig:GCA_000209225.1:NEMVEscaffold_67:1:997500:1
position: 102249-102263
TTATCAAAGCATGTTATTATGCATGTGATT102249AATGTTGTCAATGAAATAAAAATGAAATCAAGCTCAATATAGTAG
NEMVEscaffold_11 dna:supercontig supercontig:GCA_000209225.1:NEMVEscaffold_11:1:1986761:1
position: 26273-26287
TTATCAAAGCATGTTATTATGCATGTGATT26273AATGTTGTCAATGAAATAAAAATGAAATCAAGCTCAATATAGTAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ASM20922v1/TTCATTGACAACATT
lang : en | db : ASM20922v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.085 | 0.078 | search_plus_done; http://172.18.8.76:28154/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.094 | 0.010 | search_minus_done; http://172.18.8.76:28154/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.096 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).