GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-06-02 04:07:46, GGGenome : Aspergillus fumigatus (Af293) genome, s03-m05-r06 (Apr, 2016)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr5_A_fumigatus_Af293 (3948441 nucleotides)
position: 2700862-2700876
CACCTCAGAACCGGCCTGGGTGAAACGGAA2700862AATGTTGTCAATGAAGAGCAGCACGTCCTGACCCTCCTCGTCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/A_fumigatus_Af293/TTCATTGACAACATT
lang : en | db : A_fumigatus_Af293 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.076 | 0.070 | search_plus_done; http://172.18.8.72:28257/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.079 | 0.003 | search_minus_done; http://172.18.8.72:28257/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.080 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).