GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 10:50:33, GGGenome : Aedes aegypti genome, AaegL5 (Jun, 2017)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

3 dna:chromosome chromosome:AaegL5:3:1:409777670:1
position: 81313995-81314009
CGTGATCAGGAAGGACAGGATGTGCTGCTC81313995TTCATTGACAACATTTTCCGTTTCACCCAAGCTGGTTCTGAGGTA
3 dna:chromosome chromosome:AaegL5:3:1:409777670:1
position: 124229433-124229447
TTGATAGCGTTCATAAACAGCAAACTTGTG124229433TTCATTGACAACATTAAAAAGTTGCAAATTTTTTGTCCAATATTG
3 dna:chromosome chromosome:AaegL5:3:1:409777670:1
position: 207881460-207881474
TATATATATATATATAACTGCTTATCATTA207881460TTCATTGACAACATTCAGTGTGAGTGTCCAGAACCTTTATTTAAC
3 dna:chromosome chromosome:AaegL5:3:1:409777670:1
position: 235252143-235252157
CGCGATCAAGAGGGACAGGATGTGCTGCTC235252143TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTA
3 dna:chromosome chromosome:AaegL5:3:1:409777670:1
position: 394986751-394986765
AAAAGTGCATCGAAAATACTGCGTTCAATT394986751TTCATTGACAACATTTGCAGAGATCTTTGAACTGCTTTGGCCGTT
1 dna:chromosome chromosome:AaegL5:1:1:310827022:1
position: 232097759-232097773
ATGATCAAAAAACAATAACTGATCGATGTT232097759TTCATTGACAACATTTACAGGATGAAACCTAAAGGTGCTAAAAAG
1 dna:chromosome chromosome:AaegL5:1:1:310827022:1
position: 235292527-235292541
CAACTAGGAATCCGCAGAGTATAACAAAGG235292527TTCATTGACAACATTTGACCTTACATCACGATTCTACAACAAAAG
2 dna:chromosome chromosome:AaegL5:2:1:474425716:1
position: 34797470-34797484
ATTCTCGATAATCTTCAATTACTGCTGTTT34797470AATGTTGTCAATGAAAGTTGGTAATGATTACGATTCCGTACAATT
2 dna:chromosome chromosome:AaegL5:2:1:474425716:1
position: 380510979-380510993
CTTTTTAGCACCTTTTGGTTTCATCCTGTA380510979AATGTTGTCAATGAAAACATCGATTAGTTATTATTTTTTGATCAA
3 dna:chromosome chromosome:AaegL5:3:1:409777670:1
position: 105612570-105612584
CAAACATTCAAATATCGGTAATGATCTTTA105612570AATGTTGTCAATGAAAAACTGAAATTAGGTGTTTTGAAAGTTGTT
3 dna:chromosome chromosome:AaegL5:3:1:409777670:1
position: 186972577-186972591
TGAAGAGTTCCTGCCCAATGCAATGTTGAA186972577AATGTTGTCAATGAAATACCTGAACAAATCCCTACAAAAATCTTT
3 dna:chromosome chromosome:AaegL5:3:1:409777670:1
position: 309414484-309414498
TGCCAAAAATCTTTGGAATATCATGATAAT309414484AATGTTGTCAATGAAGTTGAATAGTGGCCGTTCATTAATAAAGTA
NIGP01001185 dna:scaffold scaffold:AaegL5:NIGP01001185:1:16632:1
position: 16474-16488
TACCTCAGAACCAGCTTGGGTGAAACGGAA16474AATGTTGTCAATGAAGAGCAGCACATCCTGTCCTTCCTGATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/AaegL5/TTCATTGACAACATT
lang : en | db : AaegL5 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.073 | search_plus_done; http://172.18.8.72:28000/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.007 | search_minus_done; http://172.18.8.72:28000/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.090 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).