GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2019-11-19 02:15:40, GGGenome : Atta cephalotes genome, Attacep1.0 (Jul, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold00001 dna:supercontig supercontig:GCA_000143395.2:scaffold00001:1:15679321:1
position: 14966223-14966237
AAAATATGTGAACTTACTTGTAATTTCAAT14966223TTCATTGACAACATTAAATGTTTTTAATGTAACTGCTTGAAATTT
scaffold00008 dna:supercontig supercontig:GCA_000143395.2:scaffold00008:1:7313927:1
position: 437863-437877
ATGTTAAAATTAAGTTATTATAACTTCATT437863TTCATTGACAACATTAAATTTTTAATGTACCTGTTTGAAATTTCC
scaffold00009 dna:supercontig supercontig:GCA_000143395.2:scaffold00009:1:7121624:1
position: 4196747-4196761
TGTTAAATTTAAGTTACTTATAACTTCATT4196747TTCATTGACAACATTAAATATTTTTAATGTACCTGTTTGAAATTT
scaffold00014 dna:supercontig supercontig:GCA_000143395.2:scaffold00014:1:6127344:1
position: 4425205-4425219
ATGTTAAAATTGAGTTTTTTATATTTCATT4425205TTCATTGACAACATTAAATATTTTTAATGTACCTGCTTGAAGAAT
scaffold00014 dna:supercontig supercontig:GCA_000143395.2:scaffold00014:1:6127344:1
position: 4837477-4837491
CGTTAAATTTAAGTTACTTATAATTTCATT4837477TTCATTGACAACATTAAATATTTTTAATTGAAATGTTTGCTTGAA
scaffold00015 dna:supercontig supercontig:GCA_000143395.2:scaffold00015:1:5896156:1
position: 5234040-5234054
CGTTAAATTTAAGTTATTTACAACTTCATT5234040TTCATTGACAACATTAAGTATTTTTAACGTATTTGCTTGAAANNN
scaffold00021 dna:supercontig supercontig:GCA_000143395.2:scaffold00021:1:5154485:1
position: 618518-618532
CGTTAAATTTAAGTTATTTATAACTTCATT618518TTCATTGACAACATTAAATATTTTTAATGCATGAAATTTGTTTCC
scaffold00024 dna:supercontig supercontig:GCA_000143395.2:scaffold00024:1:4810721:1
position: 3968025-3968039
TTTAAATTACTTATAAACTGTGTTGTCATT3968025TTCATTGACAACATTAAATATTTTTAATACCTGCTTGAAATTTAC
scaffold00040 dna:supercontig supercontig:GCA_000143395.2:scaffold00040:1:2629504:1
position: 481742-481756
CGTTAAATTTAAGTTACTTATAACTTCATT481742TTCATTGACAACATTAAATATTTTTAATACCTGCTTGAAATTTGC
scaffold00043 dna:supercontig supercontig:GCA_000143395.2:scaffold00043:1:2330101:1
position: 447667-447681
TGTTAAATTTAAATTACTTATAATTTCATT447667TTCATTGACAACATTAAATATTTTTAATGTAAGTAACTGCTTGAA
scaffold00045 dna:supercontig supercontig:GCA_000143395.2:scaffold00045:1:2402745:1
position: 1767046-1767060
CATAAAATGTAAGTTACTTATAACTTCATT1767046TTCATTGACAACATTAAATAAATTTATATTTTTAACGTACCTGCT
scaffold00047 dna:supercontig supercontig:GCA_000143395.2:scaffold00047:1:2221732:1
position: 1575006-1575020
TTAAGTTACTTGTGTAAGTTACTTCATATT1575006TTCATTGACAACATTTAAATATTTTTAATGTACCTGTTAGAAATT
scaffold00050 dna:supercontig supercontig:GCA_000143395.2:scaffold00050:1:2033351:1
position: 1198093-1198107
CGTTACATTTAAGTTACTTATAACTTTATT1198093TTCATTGACAACATTAAATATTTTGACAACATTTTTAATATATCT
scaffold00062 dna:supercontig supercontig:GCA_000143395.2:scaffold00062:1:1311589:1
position: 1082220-1082234
CGTAAAATTTAAGTTACTTATAACTTCATT1082220TTCATTGACAACATTAAATATTTTTAATGTACCTTCTTGAAATTT
scaffold00072 dna:supercontig supercontig:GCA_000143395.2:scaffold00072:1:950923:1
position: 119902-119916
CGTTAAATTTAAGTTACTTATAATTTCATT119902TTCATTGACAACATTAAATATTAAATATTTTTAATGTACACTGTT
scaffold00080 dna:supercontig supercontig:GCA_000143395.2:scaffold00080:1:727383:1
position: 704973-704987
TGTTAAATTTAAGTTACTTATAACTTCATT704973TTCATTGACAACATTAAATATTTTTAATGTACTTGCTTAAAATTT
scaffold00988 dna:supercontig supercontig:GCA_000143395.2:scaffold00988:1:3443:1
position: 688-702
CGTTAAATTTAAGTTACATATAACTTCAAT688TTCATTGACAACATTAAATATTTTTAATATAAAAAATTTGCTTAA
scaffold00001 dna:supercontig supercontig:GCA_000143395.2:scaffold00001:1:15679321:1
position: 15618565-15618579
AAATTTCAAGCAGGTACGTTAAAAATATTT15618565AATGTTGTCAATGAAAATAAAGTTATATAATAAGTAACTTAAATT
scaffold00014 dna:supercontig supercontig:GCA_000143395.2:scaffold00014:1:6127344:1
position: 2051328-2051342
AAATTTCAAACAGGTACATTAAAAATATTT2051328AATGTTGTCAATGAAAATAAAGTTATAAGTAACATAAATTTAACA
scaffold00014 dna:supercontig supercontig:GCA_000143395.2:scaffold00014:1:6127344:1
position: 5624396-5624410
AAATTTCAAGTAAGTACATTAAAAATATTT5624396AATGTTGTCAATGAAAATGGAGTTATAAGTAACGGAATTATAAAT
scaffold00055 dna:supercontig supercontig:GCA_000143395.2:scaffold00055:1:1662402:1
position: 905556-905570
AAATTTCAAGTAGGTATATTAAAAATATTT905556AATGTTGTCAATGAAAATGAAGTTATAACTTAAATTTAAAGTTTA
scaffold00058 dna:supercontig supercontig:GCA_000143395.2:scaffold00058:1:1577302:1
position: 334550-334564
CATTTCTAACAATGTACATTAAAAATATTT334550AATGTTGTCAATGAAAATGAAGTTATAAATAACTTAAATTTAACG
scaffold00065 dna:supercontig supercontig:GCA_000143395.2:scaffold00065:1:1202458:1
position: 910148-910162
AAATTTCAAGCAGATACATTAAAAATATTT910148AATGTTGTCAATGAAAATGAAGTTACAAGTAACTTAAATTTAACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Attacep1.0/TTCATTGACAACATT
lang : en | db : Attacep1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.083 | 0.078 | search_plus_done; http://172.18.8.76:28135/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.111 | 0.027 | search_minus_done; http://172.18.8.76:28135/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=33
0.117 | 0.007 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).