GGGenome Help | Japanese


Max number of mismatches/gaps: (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2018-08-16 16:51:47, GGGenome : Nicotiana tabacum (BX) genome, Ntab-BX (2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Ntab-BX_AWOK-SS10213
position: 241540-241554
GCCAGAAATTTCATTATCATGCTTTCTCAT241540TTCATTGACAACATTCATGACTCTTGTGCAATATTCATCTATTTT
Ntab-BX_AWOK-SS10296
position: 225503-225517
AGGCCATATATTGATTAGTTTGTCATTGTC225503TTCATTGACAACATTTTGATCTACTCACGTAGCATGGAGGAGCAC
Ntab-BX_AWOK-SS10871
position: 36900-36914
CGATCCTATCTTGACTCATTCGTCATTGTG36900TTCATTGACAACATTCTGATGTACTCCCGGACTCGTGAGGATCAT
Ntab-BX_AWOK-SS11845
position: 267906-267920
CGGCCCTATATTGACTCTTTCATCATCGTA267906TTCATTGACAACATTCTGGTGTATTCTCGGACTTGGGAGGATCAT
Ntab-BX_AWOK-SS1276
position: 192417-192431
CGGCCTAATCTTGATTCTTTCATCATTGTG192417TTCATTGACAACATTCTAGTGTATTACCGGAGTCAGGAAGATCAT
Ntab-BX_AWOK-SS12797
position: 386633-386647
AAGCCTTTCCTTGACTCCTTTGTGATAGTG386633TTCATTGACAACATTCTTGTGTATTCACAAAGTCAGGAGGACATG
Ntab-BX_AWOK-SS1325
position: 826585-826599
ATGCCATATATCAACTCGTTTGTCATCGTC826585TTCATTGACAACATTTTGATCTATTCGCGTAGTATGGAGGAGCAC
Ntab-BX_AWOK-SS13272
position: 12814-12828
CGGCCTTATCTTGATTCTTTCATCATCGTA12814TTCATTGACAACATTCTGGTGTACTCCCGGACTCGAGAGGATAAT
Ntab-BX_AWOK-SS140135
position: 11065-11079
AAACTCCTACTTATTCAGGTTCCATTTACT11065TTCATTGACAACATTTGCATGCTCAGAACTCATACATTAAGAATA
Ntab-BX_AWOK-SS145
position: 364982-364996
AAGCCCTTTCTAGACTCCATTGTGATAATG364982TTCATTGACAACATTCTGGTATATTCCTATAGTCGGGAGGACCAT
Ntab-BX_AWOK-SS14778
position: 143000-143014
AGAGATGCTGAGGGGCAGGATGTGCTTCTC143000TTCATTGACAACATTTTCAGATTTACCCAGGTTGGCTTGCCTATG
Ntab-BX_AWOK-SS161
position: 698943-698957
TATAAACATTATAGTTCATTTTAGTTATAG698943TTCATTGACAACATTGTACTTGCTATAGCTGTGGCAGCGGGAGGC
Ntab-BX_AWOK-SS16885
position: 61685-61699
AAGCCTTTTCTTGACTCCTTTGTGATAGTG61685TTCATTGACAACATTCTTGTACATTCACAAAGTCGAGAGGACCGT
Ntab-BX_AWOK-SS18243
position: 216789-216803
TTGTCACACAAGGAGTGATATCCTTACAGC216789TTCATTGACAACATTAACTTAGTTTTAGCCCCCAAAAAATACTAA
Ntab-BX_AWOK-SS1866
position: 1125459-1125473
ACGGTTGGTACTCCTTTCAGAGGGGAAGGC1125459TTCATTGACAACATTTTTGATGGCGTAACCAACGTAGTTGACCTT
Ntab-BX_AWOK-SS18789
position: 21515-21529
TCAAACGTGAAGACAAGAGCTTAATTAAAC21515TTCATTGACAACATTAATAAGTTTTAAAATTTTGAATTCGGAAAT
Ntab-BX_AWOK-SS18954
position: 992667-992681
AGGATATTCTTGGATATCTTTGTGATTGTG992667TTCATTGACAACATTTTGGTGTACTCTCGATCAGAGCCAGAGCAT
Ntab-BX_AWOK-SS19339
position: 79512-79526
AAGCCTTTCCTCGACTCTTTCGTGATAGTG79512TTCATTGACAACATTCTTGTATATTCATGAAGTCAAGAGGACCAT
Ntab-BX_AWOK-SS3033
position: 20983-20997
ACAAGTTCAAATAACTAAACAAGAGTCAAA20983TTCATTGACAACATTCAAAATACCATGTTTGTCAAAAACCCTAAT
Ntab-BX_AWOK-SS306797
position: 1249-1263
AAGCCCTTTCTATACTCCTTTGTGATAGTG1249TTCATTGACAACATTCTGGTATATTCCCAAAGTCGAGAGGACCAT
Ntab-BX_AWOK-SS310602
position: 16562-16576
TTATAAATACACTCGCATTCTTCCAAGGTA16562TTCATTGACAACATTTGCTTATGAGTTCCCACGGTTGCTCTCCCC
Ntab-BX_AWOK-SS4438
position: 336769-336783
CAGCCCTATCTTGACTCTTTCGTCATTGTG336769TTCATTGACAACATTCTGGTGTACTCCCGGAGTCGGGAGGATCAT
Ntab-BX_AWOK-SS458
position: 75448-75462
CTTACCATTATAAACTCATCTGGCCTAACA75448TTCATTGACAACATTTCATGGAAAATTTTGAGAGCTTCATTGGGC
Ntab-BX_AWOK-SS645
position: 461469-461483
GATTCATATATTAGTAAGGCAAGGTGATTG461469TTCATTGACAACATTGGGGCGTAGTGGACCATGTCAAAATAAAAG
Ntab-BX_AWOK-SS6936
position: 406193-406207
TGGCCTTATCTCGATTCGTTTGTCATAGTC406193TTCATTGACAACATTCTGGTGTATTCGCGTAGTCAGGAGGAGCAC
Ntab-BX_AWOK-SS7108
position: 13318-13332
TTGTCACACAAGGAGTGATATCCTTACAGC13318TTCATTGACAACATTAACTTAGTTTTAGCCCCCAAAAAACACTAA
Ntab-BX_AWOK-SS7555
position: 15985-15999
TAGCCATATCTTTATTATGTCGTCATCATA15985TTCATTGACAACATTTTGGTGTACTCCCGTAGTCGGGATGATCAT
Ntab-BX_AWOK-SS757
position: 936430-936444
AAGCCTTTTTTTGACTCCTTTGTGATAGTG936430TTCATTGACAACATTCTTGTATATTCATGAAGTCGGGAGGACCAT
Ntab-BX_AWOK-SS819
position: 261982-261996
AGGCTGTATATTGATTTATTTTTCATTGTC261982TTCATTGACAACATTTTGATCTACTCGCATAGCATGGAGGAGCAC
Ntab-BX_AWOK-SS8193
position: 169396-169410
ACGAGTGGTACTCCTTTTAGAGGGGAAGGC169396TTCATTGACAACATTTTTGATGGCGTATCTAATGGAGCTGACCTT
Ntab-BX_AWOK-SS8258
position: 69646-69660
AGACCTTATATTGATTCTTTTTTCATCGTC69646TTCATTGACAACATTTTGATATACTCACGTAGCTTGAGGGAGCAC
Ntab-BX_AWOK-SS8365
position: 42506-42520
CGGCCATATCTTGACTCATTCATCATTGTG42506TTCATTGACAACATTCTGGTGTACTCCCAGACTCGGGAAGATCAT
Ntab-BX_AWOK-SS8609
position: 129999-130013
TCTGACATCCGCTTCAAGGGACTTGGTTCT129999TTCATTGACAACATTACATATATGTACACCAGTCCAGTAGCATAG
Ntab-BX_AWOK-SS89217
position: 48906-48920
TGGCCCTATATTGACTCTTTCGCCATCGTA48906TTCATTGACAACATTCTGGTGTACTCCTGGACTCGGGAGGATCAT
Ntab-BX_AWOK-SS10949
position: 90862-90876
GAGATCCCAATAGTCAATCTGCTATGCTCC90862AATGTTGTCAATGAATAATCACCTTGCCTTACTAACATATGATTT
Ntab-BX_AWOK-SS1113
position: 1294473-1294487
ATCCAGTCTTATGTAAACATCATTTAATTT1294473AATGTTGTCAATGAAGTGCAAATTGTCATTTTCCATTACAAGAAC
Ntab-BX_AWOK-SS11154
position: 623-637
CAAACGTGGATTGAATAGCATATGTTGAGC623AATGTTGTCAATGAACAAGACAACTTTTGTATATTCTTTATAGTC
Ntab-BX_AWOK-SS11439
position: 410079-410093
GTGCTCCTCCATGCTACGCGAGTAGATCAA410079AATGTTGTCAATGAAGACAATGACACATGAATCAATATATGGCCT
Ntab-BX_AWOK-SS12507
position: 64534-64548
GTGGTCCTCTTGACTTCGTGAATATACCAG64534AATGTTGTCAATGAAAACTGTCACAAAGGAGTCAAGAAAAGGCTT
Ntab-BX_AWOK-SS1290
position: 1514995-1515009
TTATCCCTTGAGTACCGATCACTATTAATG1514995AATGTTGTCAATGAATCTAAAATTTATTTTCTTAAGTGCTAACTT
Ntab-BX_AWOK-SS13269
position: 85593-85607
TATCCCATGGAGTGCCAATCACTATTAATG85593AATGTTGTCAATGAATCTAAAATTTATTTTCTGGCTGTCCAGGGT
Ntab-BX_AWOK-SS149
position: 514315-514329
ATGGTCCTCTCGACTTTGTGAATATACAAA514315AATGTTGTCAATGAACACTATCACAAAGGAGTCAAGAAAAAGCTT
Ntab-BX_AWOK-SS434
position: 18171-18185
AAAGAAGAAGTGGCGATTGGTGAAGATAGA18171AATGTTGTCAATGAAAAGGTAGTGCCTCTTGCACTAGTCGTGAAT
Ntab-BX_AWOK-SS549
position: 957-971
ATCAACTTCGAGTACCATTCACTATTAATG957AATGTTGTCAATGAATCTAAAAAAATTTCTGGTTGTCCAGGGTAA
Ntab-BX_AWOK-SS7133
position: 7994-8008
CATGATCCTCCCTATTATGAGAATACACCA7994AATGTTGTCAATGAACACTATGATGAAAAAAATCATGGTATGGCT
Ntab-BX_AWOK-SS8224
position: 255615-255629
ATGGTCCTCCCAACCTCGTGAATACACAAG255615AATGTTGTCAATGAACAATATCACAAAAGAGTCGAGGAAAGGCTT
Ntab-BX_AWOK-SS8742
position: 452703-452717
GCCCAATGAAGCTCTCAAAATTTTCCATGA452703AATGTTGTCAATGAATGTTAGGCCAGATGAGTTTATAATGGTAAG
Ntab-BX_AWOK-SS9190
position: 113427-113441
ATGAACCTCATAGCTACGTGAGTATACCAA113427AATGTTGTCAATGAATACTATGATGAAAAGTCAAGATATGGCTAG
Ntab-BX_AWOK-SS9383
position: 162247-162261
ATGCTCCTCCCGGCTGCGGGAATAAATCAA162247AATGTTGTCAATGAAGACTATCACGAACGAATCCAAATATGGCCT
Ntab-BX_AWOK-SS9883
position: 124997-125011
TTGCTCCTCCCGGCTACGGGAACATATCAA124997AATGTTGTCAATGAAGACTATCATGAATGAATCCAAATAAGGCCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/BX/TTCATTGACAACATT
lang : en | db : BX | k : 0 | strand : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.092 | 0.087 | search_plus_done; http://172.18.8.76:42673/match?q=TTCATTGACAACATT&k=0&offset=0&limit=50
0.145 | 0.053 | search_minus_done; http://172.18.8.76:42673/match?q=AATGTTGTCAATGAA&k=0&offset=0&limit=16
0.162 | 0.017 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).