GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-23 03:03:23, GGGenome : Cucumis melo genome, v3.5.1 (Oct, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

CM3.5.1_scaffold00050
position: 1574831-1574845
AAGGACTTCCTAGACTCGTTCGTCATAGTT1574831TTCATTGACAACATTTTGATTTACTCCAAAATTGAGGCTGAGCAT
CM3.5.1_scaffold00034
position: 889015-889029
TTTTTTTTCCCTTTAATGAATAATTAAACT889015TTCATTGACAACATTTGGGAGTAAAAACCTCTTTCTATTCAATAA
CM3.5.1_contig35642
position: 63-77
AAGGATTTTTTAGACACGTTCGTCATAGTT63TTCATTGACAACATTTTGATTTACTTTTGTTTGCTTTGTTTGCAA
CM3.5.1_scaffold00049
position: 131555-131569
TCCAAGATTGTAGAAATGATAGAAAGAAAT131555AATGTTGTCAATGAATTTCGAACTTTTGTGGTTTGATGATGATGC
CM3.5.1_scaffold00015
position: 4956818-4956832
AATCATCTCCTGAGACATTCCACCAAACAT4956818AATGTTGTCAATGAAGGGATGAAAACTCTTTACAGCGGAAGAATT
CM3.5.1_scaffold00005
position: 4054750-4054764
TTTTGGCATATTTACCTGGGTAAAGCGGAA4054750AATGTTGTCAATGAAGAGAAGCACATCCTGTCCTTCAGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/CM3.5.1/TTCATTGACAACATT
lang : en | db : CM3.5.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.086 | 0.078 | search_plus_done; http://172.18.8.72:28279/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.091 | 0.006 | search_minus_done; http://172.18.8.72:28279/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.093 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).