GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-04-05 10:43:04, GGGenome : Onchocerca volvulus genome, Cameroon_v3 (Nov, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

OVOC_OM1b dna:supercontig supercontig:Cameroon_v3:OVOC_OM1b:1:28345163:1
position: 19041214-19041228
ATATTATCTCTTTGCTCCAAATCATGCGCT19041214TTCATTGACAACATTACTGTTATAAAATTATCGTGTTGAGAAAGT
OVOC_OM4 dna:supercontig supercontig:Cameroon_v3:OVOC_OM4:1:16048563:1
position: 10440687-10440701
GACTCATTCGTTCGGAATTGATATTACAAC10440687TTCATTGACAACATTATCATAATTAATGGGAAATTAGTATCATGA
OVOC_OM1b dna:supercontig supercontig:Cameroon_v3:OVOC_OM1b:1:28345163:1
position: 21242278-21242292
ATCTTGCAAATTAATATATGTTATCAAAGA21242278AATGTTGTCAATGAAGCGAAGTATACTTGAAACTTACTACATTAT
OVOC_OM4 dna:supercontig supercontig:Cameroon_v3:OVOC_OM4:1:16048563:1
position: 15918377-15918391
AAAGATTCAGTTACAAAGACCAACGATGCA15918377AATGTTGTCAATGAACAAAATTCAGATACCCAACAGCTGGTATTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Cameroon_v3/TTCATTGACAACATT
lang : en | db : Cameroon_v3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.153 | 0.147 | search_plus_done; http://172.18.8.76:28155/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.163 | 0.010 | search_minus_done; http://172.18.8.76:28155/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.165 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).