GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-04-05 10:24:43, GGGenome : Spirulina subsalsa PCC 9445 genome, GCA_000314005.1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH980292:4001253-4001267
CAACAGGCACTAGCCATTAAACAAGTGGTT4001253AATGTTGTCAATGAAGTGGAAACTAATCAAACTTAGTCGAACTGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/GCA_000314005.1/TTCATTGACAACATT
lang : en | db : GCA_000314005.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.077 | 0.072 | search_plus_done; http://172.18.8.72:28420/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.081 | 0.003 | search_minus_done; http://172.18.8.72:28420/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).