GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-04-05 09:16:38, GGGenome : Synechocystis sp. PCC 6714 genome, GCA_000478825.2

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr:2598375-2598389
CGGGACGTCAATAAGCAAGATGTGTTGCTC2598375TTCATTGACAACATTTTCCGTTTCGTCCAAGCTGGTTCAGAAGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/GCA_000478825.2/TTCATTGACAACATT
lang : en | db : GCA_000478825.2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.100 | 0.094 | search_plus_done; http://172.18.8.72:28497/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.107 | 0.007 | search_minus_done; http://172.18.8.72:28497/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.107 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).