GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-23 17:19:31, GGGenome : Curvularia geniculata W3 genome, ASM298223v1 (Mar, 2018)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

PQMW01000095.1 Curvularia geniculata strain W3 NODE_95_length_109432_cov_26.6063, whole genome shotgun sequence
position: 97961-97975
TTCCGAAACCAGGGACAGGATGTGTTGCTC97961TTCATTGACAACATTTTCCGGTATGTTTTTTGGCGGTAGAAGTGG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/GCA_002982235.1/TTCATTGACAACATT
lang : en | db : GCA_002982235.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.72:28849/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.004 | search_minus_done; http://172.18.8.72:28849/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.083 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).