GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-01-23 18:15:34, GGGenome : Heliconius melpomene genome, Hmel1 (Feb, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

HE670985 dna:scaffold scaffold:Hmel1:HE670985:1:89878:1
position: 18902-18916
CTTAACAAATCTCTGCTATTAAGACTGAAT18902TTCATTGACAACATTCCACAAGCATTTATTATAGCTCTTGTAAAT
HE668169 dna:scaffold scaffold:Hmel1:HE668169:1:181524:1
position: 98516-98530
CGTGACCAGGAAGGACAAGATGTGCTGCTC98516TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGTTCTGAAGTG
HE671372 dna:scaffold scaffold:Hmel1:HE671372:1:212904:1
position: 147092-147106
GTCATCCTTTTTAATACCATTTATAAAATT147092TTCATTGACAACATTAAAAAATTGATTAGGAACATGGATATTTGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Hmel1/TTCATTGACAACATT
lang : en | db : Hmel1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.071 | search_plus_done; http://172.18.8.76:28145/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.005 | search_minus_done; http://172.18.8.76:28145/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.083 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).