GGGenome Help | Japanese


Max number of mismatches/gaps: (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2019-02-21 08:17:23, GGGenome : Lottia gigantea genome, Lotgi1 (Jan, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

LOTGIsca_166 dna:supercontig supercontig:GCA_000327385.1:LOTGIsca_166:1:427803:1
position: 410244-410258
GCCCCTTATTTCACAACACAAAGCGCTGTC410244TTCATTGACAACATTAGAAACAGAAAAGTAGATTACTAACATTGA
LOTGIsca_52 dna:supercontig supercontig:GCA_000327385.1:LOTGIsca_52:1:1877736:1
position: 981473-981487
CATTATATTACCCTCAAAATATGGACCATA981473TTCATTGACAACATTAGACACGGTTTAATATGGCCATTTCGTCAG
LOTGIsca_27 dna:supercontig supercontig:GCA_000327385.1:LOTGIsca_27:1:3043282:1
position: 2985571-2985585
GCTTGGTAGCCTATGAGTCTTACTCTCTTT2985571AATGTTGTCAATGAAGGTAAACTAGTATAGCTCACTAGAAGCCAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Lotgi1/TTCATTGACAACATT
lang : en | db : Lotgi1 | k : 0 | strand : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.071 | 0.066 | search_plus_done; http://172.18.8.76:28149/match?q=TTCATTGACAACATT&k=0&offset=0&limit=50
0.076 | 0.005 | search_minus_done; http://172.18.8.76:28149/match?q=AATGTTGTCAATGAA&k=0&offset=0&limit=48
0.077 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).