GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-04-05 10:37:38, GGGenome : Linum usitatissimum genome, v1.0

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold326:110430-110444
AAAACCATCTGATCCTGACTCCTATCCGGG110430TTCATTGACAACATTACTACTCAAACCTCCTCGTTTGTAATAGGT
scaffold232:35-49
GTGCATGATCTGCTTAAGGAAATGGCTTGG35AATGTTGTCAATGAAGAAGGCAAACGCCGCATATTGATAGATCCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Lusitatissimum_BGIv1.0/TTCATTGACAACATT
lang : en | db : Lusitatissimum_BGIv1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.104 | 0.099 | search_plus_done; http://172.18.8.74:28302/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.113 | 0.009 | search_minus_done; http://172.18.8.74:28302/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.114 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).