GGGenome Help | Japanese


Max number of mismatches/gaps: (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2019-02-21 08:11:44, GGGenome : Melitaea cinxia genome, MelCinx1.0 (Jul, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold4363 dna:scaffold scaffold:MelCinx1.0:scaffold4363:1:42275:1
position: 39222-39236
TTTCTGTTTAGTGAAGTTGCATTGAATGTA39222TTCATTGACAACATTGAAAATAGCTTTTATTAAAATACTAACTGT
scaffold4438 dna:scaffold scaffold:MelCinx1.0:scaffold4438:1:10243:1
position: 283-297
ATTCTAAAAAGTACTAAACGAATTAAATAA283TTCATTGACAACATTACTAAGAAGACGGCTTTAGTATATGGTGCG
scaffold5697 dna:scaffold scaffold:MelCinx1.0:scaffold5697:1:43761:1
position: 15691-15705
CGTGACCAGGAGGGACAAGATGTACTGCTC15691TTCATTGACAACATTTTCCGTTTTACTCAGGCTGGTTCTGAGGTA
scaffold916 dna:scaffold scaffold:MelCinx1.0:scaffold916:1:135557:1
position: 16597-16611
AGTTAGTAAGTAATACAGCAACAAGTTGGA16597AATGTTGTCAATGAAATTGAAACTGTTGCATTCAGTGTAGGCTTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/MelCinx1.0/TTCATTGACAACATT
lang : en | db : MelCinx1.0 | k : 0 | strand : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.074 | 0.069 | search_plus_done; http://172.18.8.76:28151/match?q=TTCATTGACAACATT&k=0&offset=0&limit=50
0.082 | 0.007 | search_minus_done; http://172.18.8.76:28151/match?q=AATGTTGTCAATGAA&k=0&offset=0&limit=47
0.083 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).