GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-01-18 20:37:47, GGGenome : Hamadryas baboon genome, Pham (Nov, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold:Pham_1.0:Contig339613_Contig381692:1:134287:1 scaffold Contig339613_Contig381692
position: 100851-100865
CTTCTAATGTGAATATTAAATTTTATCAAA100851TTCATTGACAACATTTTTTAAACTTCTGGAACAAACCTATCTTAC
scaffold:Pham_1.0:Contig336065_Contig773325:1:168010:1 scaffold Contig336065_Contig773325
position: 44894-44908
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA44894TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
scaffold:Pham_1.0:Contig74437:1:1548:1 scaffold Contig74437
position: 198-212
GAGCCACCACGCTCTGCCTATCTTAGTTTT198TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
scaffold:Pham_1.0:Contig369620_Contig485822_Contig661302:1:21696:1 scaffold Contig369620_Contig485822_Contig661302
position: 16691-16705
TGAGCCACCACCCCTGGCCTGTCTTAGCTT16691TTCATTGACAACATTAGTATAATGTTACAGCTCCTAAGGGAGTCA
scaffold:Pham_1.0:Contig704956_Contig263510_Contig297469_Contig411775:1:50020:1 scaffold Contig704956_Contig263510_Contig297469_Contig411775
position: 1414-1428
AGCTACAGCACTCTACAGTGGACACCCACA1414TTCATTGACAACATTGTTTCTATAGGAAAACTTACTCTAATTTCA
scaffold:Pham_1.0:Contig745918_Contig535969:1:72139:1 scaffold Contig745918_Contig535969
position: 24909-24923
ACTATGCTGCACTCCAAATACTATTGTGTT24909TTCATTGACAACATTCCCTATTACATATGCATATGAAAAACAGGC
scaffold:Pham_1.0:Contig298751_Contig585199:1:48366:1 scaffold Contig298751_Contig585199
position: 40321-40335
CAGAATATATTATCGCTTTGAACACAGATT40321TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
scaffold:Pham_1.0:Contig443282_Contig733311:1:45067:1 scaffold Contig443282_Contig733311
position: 30056-30070
AAAGCTTGCATAGTTTGTTATACAGTTATT30056AATGTTGTCAATGAATTAATAGCAATTTAAGTTAATAAGACTTAA
scaffold:Pham_1.0:Contig636601_Contig794661:1:152102:1 scaffold Contig636601_Contig794661
position: 146774-146788
TCCCACAGCTCTTGGGAAACACAAGATTCA146774AATGTTGTCAATGAATATTTATCGATATCTACTTTGTTGAGAGAA
scaffold:Pham_1.0:Contig378937_Contig662582:1:306299:1 scaffold Contig378937_Contig662582
position: 48641-48655
ATGTAGTCAGCAAATAGTTAATTGCTGTTT48641AATGTTGTCAATGAAAAGGAGTGTTACACAAAATCAGAGGTTTTA
scaffold:Pham_1.0:Contig34463:1:941:1 scaffold Contig34463
position: 140-154
AATTCTATTTAATTTCTGCAGAACTTCATG140AATGTTGTCAATGAAAGAATATGAAGACTGATCTGGGGGTCCAAA
scaffold:Pham_1.0:Contig580821_Contig525316:1:94536:1 scaffold Contig580821_Contig525316
position: 62384-62398
ATTTATTGACTGATTGATGTGATAAATCCG62384AATGTTGTCAATGAAAAGATACATTGGAGGGGAAAATGTTGAACA
scaffold:Pham_1.0:Contig749330_Contig385308:1:27052:1 scaffold Contig749330_Contig385308
position: 16447-16461
GAGGGCCTTTCCAGCTCCAAGGTCAATGGC16447AATGTTGTCAATGAAAGATCAGCAGGTCAGTGCCTTATACCCAGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Pham/TTCATTGACAACATT
lang : en | db : Pham | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.089 | 0.082 | search_plus_done; http://172.18.8.76:28125/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.103 | 0.015 | search_minus_done; http://172.18.8.76:28125/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.106 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).