GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-04-05 10:39:38, GGGenome : Populus trichocarpa genome, v3.0

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr02:391325-391339
AAATGGGATGAAAAGATGGAAGAAGCTGCA391325TTCATTGACAACATTGGCTGCTACAGGCGTTATACGTTTGATAGT
Chr03:179308-179322
CCCTCCTTGATCATTCTTTGGCCTCTTCAA179308TTCATTGACAACATTTTTCAACCTATCTCTTTCTTCAGTAACCAT
Chr08:8266306-8266320
CGTGATGCTGAAGGGCAAGATGTGCTTCTC8266306TTCATTGACAACATTTTCCGCTTTACCCAGGTAAAATTCAATGCC
Chr01:35801083-35801097
CTCTTGGCAGAAACGGATGCTAAATTTCAT35801083AATGTTGTCAATGAAACTATGTTTTTGTGCTGATGTGCTTGAAAA
Chr08:3100148-3100162
ACTGATTAGCTGCTGAACTTTTGGCTTCTC3100148AATGTTGTCAATGAATCGTCTAGATAATGGTTCGCAAACTGGGAG
Chr10:13456026-13456040
GGCATCCAATTTTACCTGGGTAAAGCGGAA13456026AATGTTGTCAATGAATAGAAGCACATCTTGCCCTTCAGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Ptrichocarpa_v3.0/TTCATTGACAACATT
lang : en | db : Ptrichocarpa_v3.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.102 | 0.096 | search_plus_done; http://172.18.8.74:28312/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.113 | 0.011 | search_minus_done; http://172.18.8.74:28312/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.117 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).