GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2019-03-27 12:23:33, GGGenome : Solenopsis invicta genome, Si_gnG (Feb, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Si_gnG.scaffold08197 dna:supercontig supercontig:GCA_000188075.1:Si_gnG.scaffold08197:1:3148:1
position: 668-682
TACATTAAATTTTTGTTACGTAACTTAATT668TTCATTGACAACATTAAAATGCTTTTAATGTGCGTGATTGACTAT
Si_gnG.scaffold20281 dna:supercontig supercontig:GCA_000188075.1:Si_gnG.scaffold20281:1:662:1
position: 335-349
ATTTTATGCGAGAAAAACATGCATTCAACT335TTCATTGACAACATTCTTCTTTATCTCTTATAGTTTCGACGATAC
Si_gnG.scaffold38403 dna:supercontig supercontig:GCA_000188075.1:Si_gnG.scaffold38403:1:718:1
position: 312-326
TACATTAAATTTTTGTTACGTAACTTAATT312TTCATTGACAACATTAAAATGCTTTTACCCTGATAGCACATAAAG
Si_gnG.scaffold00805 dna:supercontig supercontig:GCA_000188075.1:Si_gnG.scaffold00805:1:1534076:1
position: 116136-116150
AGAATTCTAACTTGAATACAAATTAAGCGT116136AATGTTGTCAATGAAAATTAAGTAATGAAAATTAATCTATCTGGA
Si_gnG.scaffold09348 dna:supercontig supercontig:GCA_000188075.1:Si_gnG.scaffold09348:1:3085638:1
position: 579861-579875
TCTAGTACTTTTGACATCCTTGATTATCAC579861AATGTTGTCAATGAATAAACTTACAAAAAATTACCCTGAAAATAT
Si_gnG.scaffold55720 dna:supercontig supercontig:GCA_000188075.1:Si_gnG.scaffold55720:1:761:1
position: 11-25
ATAGCATTTT11AATGTTGTCAATGAAAATTAAGTTACGTAACAAAAATTTAATGTA
Si_gnG.scaffold65444 dna:supercontig supercontig:GCA_000188075.1:Si_gnG.scaffold65444:1:1382:1
position: 990-1004
TAGTCAATCACGCACATTATAAAGCATTTT990AATGTTGTCAATGAAAATTAAGTTACGTAACAAAAATTTAATGTA
Si_gnG.scaffold66717 dna:supercontig supercontig:GCA_000188075.1:Si_gnG.scaffold66717:1:1326:1
position: 25-39
GTGCTATCAGGGTAAAAGCATTTT25AATGTTGTCAATGAAAATTAAGTTACGTAACAAAAATTTAATGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Si_gnG/TTCATTGACAACATT
lang : en | db : Si_gnG | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.077 | 0.071 | search_plus_done; http://172.18.8.76:28159/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.007 | search_minus_done; http://172.18.8.76:28159/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.090 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).