GGGenome Help | Japanese


Max number of mismatches/gaps: (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2017-09-23 10:50:18, GGGenome : Sorghum bicolor genome, Sorbi1 (Dec, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

7 dna:chromosome chromosome:Sorbi1:7:1:64342021:1
position: 59442799-59442813
TCAGGATTTCAGCACCATACACTGTGGGGC59442799AATGTTGTCAATGAACTGATAAGCAATATTAACTGTACATAGGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Sorbi1/TTCATTGACAACATT
lang : en | db : Sorbi1 | k : 0 | strand : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.002 | 0.002 | search_start;
0.079 | 0.077 | search_plus_done; http://172.18.8.75:45343/match?q=TTCATTGACAACATT&k=0&offset=0&limit=50
0.094 | 0.015 | search_minus_done; http://172.18.8.75:45343/match?q=AATGTTGTCAATGAA&k=0&offset=0&limit=50
0.095 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).