GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-04-05 10:46:09, GGGenome : Citrullus lanatus subsp. vulgaris (Charleston Gray) genome, v1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

CG_Chr03
position: 18984140-18984154
GCAGCATTCCACGACACATTCGTAATAGTC18984140TTCATTGACAACATTTTGGTGTATTCTCGAACCGAGGCTGAGCAC
CG_Chr04
position: 18294644-18294658
AAGCACGAGGACAAAATAAGAAGGAACAAC18294644TTCATTGACAACATTCTTCTGTTTGGTAAGGTTTAACAAACAAGT
CG_Chr06
position: 1725798-1725812
TGAATTACTTCAAACATGACTTAACTTAGT1725798TTCATTGACAACATTAAAATTAACGTACTGCAACAGGGGTGCCAA
CG_Chr06
position: 7645805-7645819
TGAAGAAGATTGTGAGCTGTTGTCTTGAGT7645805TTCATTGACAACATTGAAGACTGTACCACGGAAAGATTGAAAAGA
CG_Chr02
position: 14153859-14153873
CCAAAAATGTTCTAAAAGGTAGCTAAGTCA14153859AATGTTGTCAATGAAAACCATGTAAAAGGCTCATAAAAAGTATCT
CG_Chr05
position: 19161869-19161883
AAAAAGTGTTCTTAAAAGGTAACTAAGTCA19161869AATGTTGTCAATGAAAACCATGTAGAAGGTTACTGAAAAGTGTCC
CG_Chr05
position: 34262451-34262465
CACAAGCTTGCTTACCTGGGTAAAACGGAA34262451AATGTTGTCAATGAAGAGAAGCACATCTTGCCCTTCAGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/WCG_v1/TTCATTGACAACATT
lang : en | db : WCG_v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.087 | 0.081 | search_plus_done; http://172.18.8.72:28214/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.095 | 0.008 | search_minus_done; http://172.18.8.72:28214/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.098 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).