GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-06-02 05:27:57, GGGenome : Zootermopsis nevadensis genome, ZooNev1.0 (Jun, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold1238 dna:supercontig supercontig:GCA_000696155.1:scaffold1238:1:225058:1
position: 85411-85425
AGGCAATCATGTTCAGTTTAAAGCAGCTGC85411TTCATTGACAACATTAAAATAGTAAAAAATCCAATATTTCATGCA
scaffold864 dna:supercontig supercontig:GCA_000696155.1:scaffold864:1:1795710:1
position: 561420-561434
CGAGACCAAGAAGGACAGGATGTGCTGCTG561420TTCATTGACAACATTTTCAGGTTCACCCAAGCTGGTTCAGAGGTT
scaffold320 dna:supercontig supercontig:GCA_000696155.1:scaffold320:1:1007469:1
position: 374877-374891
AACCATGCTGTTTAATGCATGTTCTTAATT374877AATGTTGTCAATGAACTTTGCTTATCAGAAGGTTTTAAGTCACTT
scaffold543 dna:supercontig supercontig:GCA_000696155.1:scaffold543:1:1182582:1
position: 573458-573472
TATGGGAACCCTGTAAATGCCTAGTTGTGG573458AATGTTGTCAATGAAACAATAAGGCAATAGACCACATGTAACGTA
scaffold668 dna:supercontig supercontig:GCA_000696155.1:scaffold668:1:2084236:1
position: 1985162-1985176
TTATATTTTATGTTGGTCATGTTTACTCTA1985162AATGTTGTCAATGAAATTCATTTTGGTTCATATTGGTGAATTGTA
scaffold4 dna:supercontig supercontig:GCA_000696155.1:scaffold4:1:3442531:1
position: 2802167-2802181
CGCTTTGATATTTGTCCAAAATTTTGTCAG2802167AATGTTGTCAATGAAGCGACGGATTGGGGTTATGAGCATCGTAGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ZooNev1.0/TTCATTGACAACATT
lang : en | db : ZooNev1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.076 | 0.070 | search_plus_done; http://172.18.8.76:28165/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.081 | 0.005 | search_minus_done; http://172.18.8.76:28165/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.083 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).