GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-04-05 09:43:10, GGGenome : Panda genome, BGI-Shenzhen 1.0/ailMel1 (Dec, 2009)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

GL192506.1:1754553-1754567
TAGAATATATTATCACTTTAAACACAGATT1754553TTCATTGACAACATTCTGTGGGCATCCATTTAATATTAATATTAA
GL192533.1:1201064-1201078
TAATCATTTCTTTTCTCTAGTTACACTATC1201064TTCATTGACAACATTTATTGCATAGACAAATAACACAAGTCTTGC
GL192612.1:1048978-1048992
GGCGAAGACAGCACAGTTGCCTGATGACCT1048978TTCATTGACAACATTGCTGTTTACCTTGGAGTCAGAAAAGCCCTC
GL192782.1:184041-184055
ATAGTCATGCACTCTTTTAAGTAGCATATA184041TTCATTGACAACATTTTAAATGTCTTTGATATTCTCAAAATTATA
GL192961.1:799078-799092
TTAAAGTAGATTAAATGTTAAAATTTGTTT799078TTCATTGACAACATTCAAATGAAAACATCCCTGGTCAGTGGCTGT
GL192996.1:870861-870875
CATGATCACAATCTGAGTCATGTAATTGAG870861TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCACTGTTC
GL193045.1:723228-723242
GAAAGATTAAAATTCTGATTCTCCTTAGTT723228TTCATTGACAACATTGTAGACGAGAAGACAGGATTTGGTGTTCAG
GL193567.1:38306-38320
AATTATAATTTCTATTTAAAAGCTCAAATT38306TTCATTGACAACATTGCCAGTTGTTTCCCTCGAAGTAGCACTACT
GL192362.1:2303694-2303708
GCCTGTTTTTCATATGCATATGTAATAGTG2303694AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATACT
GL192368.1:3960448-3960462
TGTGATAGTAAGTTTTGGGTAACTTTTATA3960448AATGTTGTCAATGAAAGGGTACCTGGGTGCCTCAACTGATTAAGC
GL192542.1:25103-25117
GTAGAGTGTGAAAAACTTCCTGGCCAAAAC25103AATGTTGTCAATGAAGCCACAACTAGCCAGCTTCACCCTTATGAT
GL193544.1:402458-402472
TAAATAAAATTAAGAAATCTGACAATACCA402458AATGTTGTCAATGAAGTGGGATGATAGGAACTTTCAGGCACTGCT
GL193809.1:95506-95520
GGGAATTATCTGTCCTGGAATTTTCCATCA95506AATGTTGTCAATGAAGGGAGGGGGAGGTGATTAGTACTACGCCTG
GL194809.1:79254-79268
CCAATCCAATGCCTTGGCACACACATTATA79254AATGTTGTCAATGAAATTAGATACATATATAATATGTTCCGAGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ailMel1/TTCATTGACAACATT
lang : en | db : ailMel1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.076 | 0.070 | search_plus_done; http://172.18.8.77:28049/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.011 | search_minus_done; http://172.18.8.77:28049/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.092 | 0.005 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).