GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-18 09:23:21, GGGenome : Golden eagle genome, aquChr-1.0.2/aquChr2 (Oct, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

KN265692v1:8019863-8019877
GATCTAGTATTTTGTCCCATCTAAAAACTG8019863TTCATTGACAACATTAAGGAACACTGTCTGAATGCTGAAGCCATC
KN265795v1:525652-525666
TACAGTACTCTAAATAACTCACTGTAATAT525652TTCATTGACAACATTATTTTGTGCATTGTATGGTTCTTGTAATTT
KN265812v1:166390-166404
CATGATAACAATCTGTGTCATGTAATTGAG166390TTCATTGACAACATTTAAATAATCCATTGCTCGTTTCCATTGTTC
KN265653v1:6072095-6072109
CCCTGCCACAGTTTGCCCACTGCTAGCTTG6072095AATGTTGTCAATGAACACTGTAGAAAGGTGTGATGTTGCTGTGCT
KN265663v1:2926063-2926077
GTTAAAAATATATATATGCAGCTTAAAGGA2926063AATGTTGTCAATGAATAAAATAATTATTAAAATATCAGTAATTGT
KN265693v1:7229413-7229427
TTGTTATTAAATGATGGACATTGGACATCC7229413AATGTTGTCAATGAAAAGTATTATTAAAATTCATGTTCTAGATAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/aquChr2/TTCATTGACAACATT
lang : en | db : aquChr2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.087 | 0.080 | search_plus_done; http://172.18.8.76:28760/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.097 | 0.010 | search_minus_done; http://172.18.8.76:28760/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.097 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).