GGGenome Help | Japanese


Max number of mismatches/gaps: (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2017-08-24 02:29:06, GGGenome : Ipomoea nil (Tokyo Kokei Standard; TKS) genome (Sep, 2016)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

BDFN01000298.1 Ipomoea nil DNA, scaffold: scaffold0298, cultivar: Tokyo-kokei standard.
position: 271079-271093
AGAGATGCTGAGGGTCAGGATGTGCTTCTT271079TTCATTGACAACATTTTCAGGTTCACACAGGTTTGTTTATTTCTA
BDFN01000465.1 Ipomoea nil DNA, scaffold: scaffold0465, cultivar: Tokyo-kokei standard.
position: 2405428-2405442
CAACCATATTGTTCTTATGTTTCAGTTTGT2405428TTCATTGACAACATTATTATAACTTGTGTAACAGGTTGGGTAAAT
BDFN01001834.1 Ipomoea nil DNA, scaffold: scaffold1834, cultivar: Tokyo-kokei standard.
position: 3641579-3641593
ATAATCAGTCAATTTTTGAAACTTCAGTTT3641579TTCATTGACAACATTTAATCATTTTTTTAATTTCAAAATGAAGGA
BDFN01002694.1 Ipomoea nil DNA, scaffold: scaffold2694, cultivar: Tokyo-kokei standard.
position: 2654643-2654657
GTTAGTTATTGTCCAGAAATTAATTTCTGA2654643TTCATTGACAACATTTATATATATATATATATATATATATATATA
BDFN01001576.1 Ipomoea nil DNA, scaffold: scaffold1576, cultivar: Tokyo-kokei standard.
position: 4866587-4866601
ATCTCTCCAATTGCTGGTATGTCATCAGAT4866587AATGTTGTCAATGAAATGGCTGGAGAATCTACCCCTTCCACCAGT
BDFN01002537.1 Ipomoea nil DNA, scaffold: scaffold2537, cultivar: Tokyo-kokei standard.
position: 540128-540142
TTTTTTTTTATGGAAAAAGAAATTAAAAAG540128AATGTTGTCAATGAAATATATATAGTTACCTGTTTTTCTTTGTTG
BDFN01002545.1 Ipomoea nil DNA, scaffold: scaffold2545, cultivar: Tokyo-kokei standard.
position: 111092-111106
TATAAATTAAAAAAAAAAATCAATGACTTT111092AATGTTGTCAATGAAAATTATGTACGCCACTTTATTACTCTTATT
BDFN01003104.1 Ipomoea nil DNA, scaffold: scaffold3104, cultivar: Tokyo-kokei standard.
position: 2953851-2953865
GCGAGCCTTAAAGAAAAGGAGATACTGGAT2953851AATGTTGTCAATGAATCTCGGGCAAAGAAGGCATACCACTTGGAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/asagao/TTCATTGACAACATT
lang : en | db : asagao | k : 0 | strand : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.002 | 0.002 | search_start;
0.081 | 0.079 | search_plus_done; http://172.18.8.72:42903/match?q=TTCATTGACAACATT&k=0&offset=0&limit=50
0.100 | 0.019 | search_minus_done; http://172.18.8.72:42903/match?q=AATGTTGTCAATGAA&k=0&offset=0&limit=46
0.103 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).