GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-30 05:46:45, GGGenome : Lancelet genome, JGI 1.0/braFlo1 (Mar, 2006)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chrUn:32047166-32047180
AGACATAAGAGAATACGATGATAAACTATT32047166TTCATTGACAACATTTGAATGATTTTCTTTAAAAAACAACGTTGC
chrUn:35973901-35973915
TGTTAGACCTTTATTCTGAATATTGCTACA35973901TTCATTGACAACATTTCTGCTTACAATATGTTACTGAGAAAGGCT
chrUn:44790084-44790098
TCATGCATAATGGCGGGGAGACTGAAATAT44790084TTCATTGACAACATTTTCTGGCTTCCTCATTTTAGGAAGATAAAC
chrUn:336867124-336867138
AAAATTTCAGTGACACTTTTTCATGAGTAA336867124TTCATTGACAACATTTAACATTTAACAATTGACAATGATTCAAAT
chrUn:343398172-343398186
ATCAATTTGTAAAAAAACATGAATATAGCC343398172TTCATTGACAACATTCATCAGTGAAAAAGGCAGCCATCGCGCAAT
chrUn:346092820-346092834
ATAAGACTTTGCAGAATCAGTGGATGCCTT346092820TTCATTGACAACATTGATTGGTGTTGGACAGTGAAANNNNNNNNN
chrUn:354650286-354650300
TGTTAAACCTTTCTTCTGAAGAGTGCTACA354650286TTCATTGACAACATTTCTGCCTACAATATGTTACTGAGAAAGGCT
chrUn:53572706-53572720
TGCTGGTGTAAACAAAATGTCCTACATGTA53572706AATGTTGTCAATGAAATCTAATAAAAAATGTAAATTAAGAAATTC
chrUn:133911774-133911788
ACGTATGTAATTTGTCAGCGATTCTGTTTT133911774AATGTTGTCAATGAATGGTTAGCAATGGGTAGCATGGTAGAACAT
chrUn:200618751-200618765
AATTCTTCTAGGATGTGTTTTATACTTTTA200618751AATGTTGTCAATGAAAAACAGACTTTCATCAAAGTTGTCATAAAT
chrUn:406363064-406363078
GAATACCTTGAGGGAAGGAAATGCCTAAGA406363064AATGTTGTCAATGAATATAGTGTTTATGATTTGCATTTTATTAAG
chrUn:646339252-646339266
GCACGATGTCTGCATCCCAGTTCACTGATG646339252AATGTTGTCAATGAAGGCCATATTAAGTTTTATGTTTTTTTACAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/braFlo1/TTCATTGACAACATT
lang : en | db : braFlo1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.084 | 0.078 | search_plus_done; http://172.18.8.76:28091/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.095 | 0.011 | search_minus_done; http://172.18.8.76:28091/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.096 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).