GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-04-05 10:06:00, GGGenome : Dog genome, Broad CanFam3.1/canFam3 (Sep, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:31059729-31059743
ATAATCAAAAATAACACTGCAACAGTGCAG31059729TTCATTGACAACATTTGCTTTCCAATCGTGCCAACTAAGAAAAAA
chr3:8039506-8039520
CATGATCACAATCTGAGTCATGTAATTGAG8039506TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCACTGTTC
chr4:18669159-18669173
AATAAATTGAAAAGGACAAAGAGAATTTCA18669159TTCATTGACAACATTTTGTAAAATTATTTTATTTATTTATTTTAC
chr5:77585856-77585870
AACTATGATTTTTTCCTTTGAAATCTATTT77585856TTCATTGACAACATTTATCCCTTATCTTCTCTCTCCAATTGTGAG
chr12:36189504-36189518
ATTGAGGCCAGAGCTCCGTCCTGAATTAGG36189504TTCATTGACAACATTCCCTTACCACACTCTTTCTCAGACTTTAAG
chr15:47120580-47120594
TAGAATATATTATCACTTTAAACACAGATT47120580TTCATTGACAACATTCTGTGGGCATCCATTTAATATTAATATTAA
chr20:25899526-25899540
AGTCGACAACAAAAGCACTATCTGTGTTGT25899526TTCATTGACAACATTTCTGAAGTGGCCATTTATCTCTCACAGCAA
chr33:24673054-24673068
TTCTGAGAATTTAATGGAAAACATGATGAC24673054TTCATTGACAACATTGCAATGTATAATTGAAATTTGCTAAGAGAG
chr4:19203784-19203798
TTTTATATGCATTTCTGTTTCTTATGTTGT19203784AATGTTGTCAATGAAATTCATGAGAAAAATTTGAATGTGAGGTAG
chr4:83419030-83419044
ATTCCCACTGACTAGGAATGTTTTCATTTA83419030AATGTTGTCAATGAAAACCAAATGTTAACACTAATCTCCTTTAAT
chr13:5343647-5343661
ATTTTTAAAAATACATATAATACTCTCAAT5343647AATGTTGTCAATGAAGAGATGAGTATAAAGGGAAAATGAGGGCAA
chr14:33611558-33611572
TGCCTTATTGCTAATCATGGCACCCTTTGG33611558AATGTTGTCAATGAATGTTAACAGAAGTAAAAGAAGATATTCAAA
chr21:2118723-2118737
TTCCCAAAGATAGAGCAAATTCATTTAAAA2118723AATGTTGTCAATGAAAACTTGACCTAGAATTTATTTCACAAATAT
chr31:21594945-21594959
TTAAAGTCATTGGTGTTTTCAGACGTTAAG21594945AATGTTGTCAATGAAATGTGGAGATGCTCCAGCCTTCCAGCTATT
chr34:13806763-13806777
TATAATATTCATTATAAATGCTGACACATA13806763AATGTTGTCAATGAAAAAAATTAAGTCCAAGACAAACTTGTAGCA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/canFam3/TTCATTGACAACATT
lang : en | db : canFam3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.076 | 0.070 | search_plus_done; http://172.18.8.78:28030/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.010 | search_minus_done; http://172.18.8.78:28030/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.092 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).