GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:48:18, GGGenome : DDBJ release 120.0 (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Human BAC clone GS1-312P20 from 5p15.2, complete sequence.
AC002123.1:133597-133611
CCTGGGTATAATGCACTGATCTGCTGATCT133597TTCATTGACAACATTGCCATCGACTTTGGAGCTGGAAAGGCCCTC
Human BAC clone CTB-191D16, complete sequence.
AC002460.1:73482-73496
CAGAATATATTATCGCTTTAAACACAGATT73482TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
Homo sapiens chromosome 19 clone CTD-2356P16, complete sequence.
AC008962.9:39696-39710
AAGCCACCACACCCGGCCTATCTTAGCTTT39696TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Homo sapiens chromosome 8, clone CTC-386L14, complete sequence.
AC090816.3:66203-66217
GTATTTTTAAATTCATCGATATTTCCACTT66203TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Homo sapiens chromosome 3 clone RP11-421B21 map 3p, complete sequence.
AC090949.2:117016-117030
ATTGTAATAGCCAGAAATTGGAAACATATA117016TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Homo sapiens chromosome 5 clone CTD-2105K20, complete sequence.
AC091838.2:60349-60363
CCTGGGTATAATGCACTGATCTGTTGATCT60349TTCATTGACAACATTGCCATCGACTTTGGAGCTGGAAAGGCCCTC
Homo sapiens BAC clone RP11-340B18 from 4, complete sequence.
AC097502.3:52626-52640
AAAAACGTCTGATTTTGTGTAACACTCCTT52626TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
Homo sapiens BAC clone RP11-182K3 from 2, complete sequence.
AC104598.4:73478-73492
ATTGCAGCAAAGAAGCACATTTATATTCTA73478TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
Homo sapiens 3 BAC RP11-474M18 (Roswell Park Cancer Institute Human BAC Library) complete sequence.
AC107025.3:78694-78708
TTGGTTTTGTATATATTAAATAGTTGAAAC78694TTCATTGACAACATTAAGTTTGTTTTCTAGGCTCTATTGGGATAA
Homo sapiens BAC clone RP11-452J21 from 4, complete sequence.
AC108063.3:105748-105762
AACGAAAGGCGTTTGAGGAAAGCCTGATAA105748TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
Homo sapiens chromosome 18, clone RP11-784B15, complete sequence.
AC117569.3:88246-88260
ATATTTATATATGTATATATTTCATATTAT88246TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
Homo sapiens neuregulin 1 (NRG1) gene, partial cds, alternatively spliced.
AF491780.1:103463-103477
GTATTTTTAAATTCATCGATATTTCCACTT103463TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Human DNA sequence from clone RP11-170N11 on chromosome 1.
AL354654.15:105182-105196
CTAATTAATGAATAGTAAGTATATTTTCTC105182TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
Human DNA sequence from clone RP11-173B15 on chromosome 6.
AL360220.12:37485-37499
CTATTTCAATCAACCATCTTGTAATCATAC37485TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
Human DNA sequence from clone RP11-661D17 on chromosome 13.
AL445604.9:147395-147409
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA147395TTCATTGACAACATTTCCTGAGGTAACTCACACTGAGGTGACAAC
Pan troglodytes BAC clone CH251-643N11 from chromosome 7, complete sequence.
AC188940.3:129735-129749
TATATTTGTTATAGAATATTATGTTAAATC129735TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT
Pan troglodytes BAC clone CH251-639B17 from chromosome 7, complete sequence.
AC192004.3:189879-189893
GTGGTGCCTGGCCTGAGTCAGCTCAGTAGC189879TTCATTGACAACATTGGTTCGTTTAACAAATATTGCCTGAGAAGA
Macaca mulatta BAC CH250-327F20 () complete sequence.
AC202850.6:193298-193312
GTGAGCCACCACACCGGCCTATCTTAGCTT193298TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Macaca fascicularis complete genome, chromosome chr2.
LT160001.1:79404853-79404867
ACTATGCTGCACTCCAAATACTATTGTGTT79404853TTCATTGACAACATTCCCTATTACATATGCATATGAAAAACAGGC
Rattus norvegicus Mcs BAC CH230-1A1 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence.
AC091242.12:72597-72611
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT72597TTCATTGACAACATTAAATATTTACTGAATCTTAAATCTTATCCT
Rattus norvegicus Mcs1 CH230-3I8 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence.
AC094490.9:77809-77823
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT77809TTCATTGACAACATTAAATATTTACTGAATCTTAAATCTTATCCT
Mus musculus chromosome 3, clone RP23-341B15, complete sequence.
AC102806.18:103943-103957
ATTGCAAACCTTAACTTACAGGGATGTTTA103943TTCATTGACAACATTTTACTTATTTTTCATTTCTCTGATGTTTAA
Mus musculus chromosome 3, clone RP23-49O22, complete sequence.
AC107701.8:76582-76596
TAGATTCTGCCTCAGAACTTGTAGTTGAAG76582TTCATTGACAACATTGGTCAACATGCAGCTTGAATCTGGGGCAAC
Mus musculus chromosome 5, clone RP23-330E5, complete sequence.
AC118200.8:51451-51465
TAGAATCAGTGTAAGCCATCCCTACACTTA51451TTCATTGACAACATTCATGCAATCTTCAGTGTTCATTACTTTGCT
Mus musculus BAC clone RP23-109J14 from 1, complete sequence.
AC125216.3:133794-133808
GAATACTTAATGTACCATTTGGAAACACTG133794TTCATTGACAACATTTTATTTGCTATTTCCTGCTGTCTTTAAAAA
Rattus norvegicus CH230-12L9 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence.
AC132498.4:110866-110880
CCTCTCCCATTTACATTTAGTTTTAAGTAA110866TTCATTGACAACATTTTTTGCATTGTTCAGCCCTTTACCTGTATT
Mus musculus BAC clone RP24-159A20 from chromosome 5, complete sequence.
AC152165.2:163547-163561
GTCAACATGTACTTTAAACTTTAGTAATGT163547TTCATTGACAACATTGATGCTTTTGGCTTGGGGGCATGGATGCTA
Mus musculus 6 BAC RP23-387H1 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence.
AC158660.4:195953-195967
AAAGTACTATCAGTTTCCTAAATATATCCA195953TTCATTGACAACATTGTTCACTCTTCCATAAACATCTGCTGGTTA
Mouse DNA sequence from clone RP23-307O24 on chromosome 2.
AL831781.8:102647-102661
AGACAAATTAAGACTGTATTGTATCATGGT102647TTCATTGACAACATTTAAAATTGTTACATATTTCAAAATTTTTTA
Mouse DNA sequence from clone CH29-502J5 on chromosome 6.
CU207317.13:16788-16802
TGAACACATTCTCCCTGTTTGTGTCATCAC16788TTCATTGACAACATTTAACTGGGCCTTCTGTGTGGATACCATGAT
Sciurus carolinensis genome assembly, chromosome: 1.
LR738590.1:65607828-65607842
ATTACACTGCCTGTTCGTCTTCTTTTGCAT65607828TTCATTGACAACATTTCATTGTAAGCCTTTCTAGTCCTAAGTTTT
Sciurus carolinensis genome assembly, chromosome: 2.
LR738591.1:107693935-107693949
CGGGCAGGAAAAGAGCCATCCAGGAGGTGC107693935TTCATTGACAACATTTTGGGAGGAACAGTTCCCTTTAGGCAGATG
Sciurus carolinensis genome assembly, chromosome: 3.
LR738592.1:128834629-128834643
AACTAGTGAATTGATAATGCTGATTTTTTT128834629TTCATTGACAACATTATAAAATATAGAAGATAAATAAGTACTTTT
Sciurus carolinensis genome assembly, chromosome: 4.
LR738593.1:71137194-71137208
GTGATTTATTCATTCTGATTTGAATTTTCA71137194TTCATTGACAACATTTCTTAGAAAGGGGGCACATACCAGTAGGAA
Sciurus carolinensis genome assembly, chromosome: 4.
LR738593.1:134650461-134650475
TGGATAATCTCTAGGCTCATTAGGAAGATG134650461TTCATTGACAACATTCTAGGAATTGCTGATCTAAATCATCTTTGC
Sciurus carolinensis genome assembly, chromosome: 4.
LR738593.1:135868885-135868899
CTGAGCTCACACCAAGGTCCTATGATGAGC135868885TTCATTGACAACATTCTAAGGCTTCTCTAGCCTATGTCTCCAAAG
Sciurus carolinensis genome assembly, chromosome: 5.
LR738594.1:39341201-39341215
AAATTATGAAATCTAACATAAAAATCATCA39341201TTCATTGACAACATTAATAGTTAATAAATGTAGAAAATTTTACTC
Sciurus carolinensis genome assembly, chromosome: 6.
LR738595.1:80796469-80796483
GAATCAAAGGTCAAAATTTAAAGAAATGAT80796469TTCATTGACAACATTAAATATTTACTGAATCTCAACTTTTTCCTG
Sciurus carolinensis genome assembly, chromosome: 8.
LR738597.1:35470775-35470789
CTCTTTACCTTATAAGAATGTAGCCTCTTT35470775TTCATTGACAACATTTTTACTTAAATGGCAGAAAGATCAAGAGGG
Sciurus carolinensis genome assembly, chromosome: 9.
LR738598.1:17116716-17116730
CCATTTATATTAATTTCTAAGCTTATTTTA17116716TTCATTGACAACATTTAAGTTACTGTAGGACTTAGAGTGCAGTAC
Sciurus carolinensis genome assembly, chromosome: 9.
LR738598.1:112299787-112299801
CTCTCTAATGGTCAACATAACATATTCAAT112299787TTCATTGACAACATTCATTATGGGCCATTAATTTTATTCTATAAT
Sciurus carolinensis genome assembly, chromosome: 10.
LR738599.1:123787557-123787571
GATGATAATATATTTACTTGATACCATATA123787557TTCATTGACAACATTCTTCTGTTATTTTTGGTTCGGAGAATACTT
Sciurus carolinensis genome assembly, chromosome: 11.
LR738600.1:60700667-60700681
TAGAATGTAATGTAACTGAAAGAAAAAGTT60700667TTCATTGACAACATTTATTGTTAATGTGCAGTTTATTTTTACTTT
Sciurus carolinensis genome assembly, chromosome: 14.
LR738604.1:62976319-62976333
GTTAAAATTTTAAAATGGGATATATTTAAT62976319TTCATTGACAACATTAAAAAAAATTCTATTTTCAATGGCTTTGGT
Sciurus carolinensis genome assembly, chromosome: 17.
LR738607.1:52110747-52110761
AGTATGCTGCACTCCAAATACCATTGTGTT52110747TTCATTGACAACATTCACTGTTACATATGCATATGAAAAACAGGC
Sciurus vulgaris genome assembly, chromosome: 1.
LR738611.1:198320633-198320647
TTCATTCAGTTGGTTAACACCTGAAGCACC198320633TTCATTGACAACATTGATATCCTAAGCTAGCCCTTGAAAGGCCAA
Sciurus vulgaris genome assembly, chromosome: 2.
LR738612.1:97198699-97198713
GATCTAATCAGTGAAACTTAAACTCACTGG97198699TTCATTGACAACATTAAAAGATTAATGTTAATGTTAAATGTAATA
Sciurus vulgaris genome assembly, chromosome: 5.
LR738615.1:137797406-137797420
TGGATCATTTCTAGGCTCATTAGGAAGATG137797406TTCATTGACAACATTCTAGGATTTGCTGAACTAAATCATCTTTGC
Sciurus vulgaris genome assembly, chromosome: 5.
LR738615.1:139109071-139109085
CTGAGCTCACACCAAGGTCCTATGATAAGC139109071TTCATTGACAACATTCTAAGACCTCTCTAGCCTGTGTCTCCAAAG
Sciurus vulgaris genome assembly, chromosome: 6.
LR738616.1:83507239-83507253
CATGATAACAATCTGAGTCATGTAGTTGAG83507239TTCATTGACAACATTTAAATAATCCATAGCTCTTTTCCACTGTTC
Sciurus vulgaris genome assembly, chromosome: 8.
LR738618.1:35938805-35938819
TCTTTACCTTATAAGAATGTAGCCTTTTTT35938805TTCATTGACAACATTTTTACTTAAATGGCAGAAAGATCAAGAGGG
Sciurus vulgaris genome assembly, chromosome: 9.
LR738619.1:84979856-84979870
AGTTTTCCCAATGAGCCAATAAGCTGTAGA84979856TTCATTGACAACATTAGCTGTGCTTATAAGCTCAATCTCTCTTTC
Sciurus vulgaris genome assembly, chromosome: 10.
LR738620.1:9263039-9263053
GGGAGCAAGACAAGGACAAGCTTGAGTATA9263039TTCATTGACAACATTGAAGCCTACAATACGACCCTCCTCACAAAG
Sciurus vulgaris genome assembly, chromosome: X.
LR738621.1:50873969-50873983
ACTTTCTTTAAGTATTTCACATATTTCAAA50873969TTCATTGACAACATTAATTTTAAGATCAGTTTTCCCATTTCTACA
Sciurus vulgaris genome assembly, chromosome: 11.
LR738622.1:56140488-56140502
TAGAATGTGATGTAACTGAAAGAAAAAGTT56140488TTCATTGACAACATTTATTGTTAATGGGCAGTTTATTTTTACTTT
Sciurus vulgaris genome assembly, chromosome: 16.
LR738627.1:48603204-48603218
AGTATGCTGCACTCCAAATACCATTGTGTT48603204TTCATTGACAACATTCATTATTACATATGCATATGAAAAACAGGC
Pteropus vampyrus clone CH279-375K22, complete sequence.
AC204458.3:16771-16785
CTCACCCAAAGGGTTGGGTAACAGGGAAAT16771TTCATTGACAACATTTGGGCAAAAGTATTTGGGGAGATGCCCTTT
Felis catus Senzu DNA, chromosome: B2, American Shorthair breed.
AP023156.1:81825232-81825246
GTTGGGGCCAGAGTTCCATCCAGAATTAAG81825232TTCATTGACAACATTCCCCTCACCACTCACTCTTTCCCAGACTTT
Ovis canadensis canadensis isolate 43U chromosome 2 sequence.
CP011887.1:195228141-195228155
TTTGTAATACATTTATCAAATAAAGGAGAA195228141TTCATTGACAACATTTACCCAAGTGAATTACAGGGTCAAAAATGC
Ovis canadensis canadensis isolate 43U chromosome 3 sequence.
CP011888.1:185504471-185504485
AAGAGAATTCCAGAAAACCATCTACTTCTC185504471TTCATTGACAACATTAAAACTTTTAGCTGTGTGGATCACAAGAAA
Ovis canadensis canadensis isolate 43U chromosome 4 sequence.
CP011889.1:7487058-7487072
TAAATGATCTGCCTTTTTTAGAGTAATCAT7487058TTCATTGACAACATTTCGAACACTTTGTAGCAAAAGAAAATAAAG
Ovis canadensis canadensis isolate 43U chromosome 4 sequence.
CP011889.1:74559753-74559767
ACTCCCCTAAATATAAGTCCCATTTCTCCT74559753TTCATTGACAACATTTCAAACAGTATATATCTTCTGTTTAAATTT
Ovis canadensis canadensis isolate 43U chromosome 6 sequence.
CP011891.1:95351025-95351039
GAATAATTAGAGATCTGAGATAACCTCTCG95351025TTCATTGACAACATTACTGTGGTTATGACAGTATTATTCTTTATA
Ovis canadensis canadensis isolate 43U chromosome 8 sequence.
CP011893.1:932378-932392
CCAGAGCTTCTGCTTCTGTCCTGAATTAGG932378TTCATTGACAACATTCCCTTCACCACCCTACTCTTTCTTATACTT
Ovis canadensis canadensis isolate 43U chromosome 23 sequence.
CP011908.1:24098996-24099010
TAGAAGTTCTTAATGTTTGTTTTCTTGGCT24098996TTCATTGACAACATTCCTTTTTGTTGTTGTGTGATCTCATCCGCT
Bos mutus isolate yakQH1 chromosome 4.
CP027072.1:7213012-7213026
TAAATGATCTGCCTTTTTTAAAGTAATCAT7213012TTCATTGACAACATTTCGAACACTTTGTAGCAAAAGAAAATAAAG
Bos mutus isolate yakQH1 chromosome 9.
CP027077.1:13850441-13850455
CCAGAGCTTCTGCTTCTATCCTGAATTAGG13850441TTCATTGACAACATTCCCTTCACCACCCTACTCTTTCTTATACTT
Bos mutus isolate yakQH1 chromosome 13.
CP027081.1:74532288-74532302
AGAAGTGTAATTACTGGGTCAGAATATGGA74532288TTCATTGACAACATTTGGGCTTGTTAAAAATTCAGGTTATTGAGT
Bos mutus isolate yakQH1 chromosome 19.
CP027087.1:22263363-22263377
CAGTGACTCCCCCTGACTCACTGCTTTAAA22263363TTCATTGACAACATTTTTTAAAAGGTAGAGAATTCTCATGAAAAG
Bos mutus isolate yakQH1 chromosome 24.
CP027092.1:23599102-23599116
TAGAAGTTCTTAATGTTTGTTTTCTTGGCT23599102TTCATTGACAACATTCCTTTTTGTGTGACCTCATCCACTACCAGC
Canis lupus familiaris breed Labrador retriever chromosome 15a.
CP050569.1:47157404-47157418
TAGAATATATTATCACTTTAAACACAGATT47157404TTCATTGACAACATTCTGTGGGCATCCATTTAATATTAATATTAA
Canis lupus familiaris breed Labrador retriever chromosome 20a.
CP050571.1:26006734-26006748
AGTCGACAACAAAAGCACTATCTGTGTTGT26006734TTCATTGACAACATTTCTGAAGTGGCCATTTATCTCTCACAGCAA
Canis lupus familiaris breed Labrador retriever chromosome 04a.
CP050572.1:18907897-18907911
AATAAATTGAAAAGGACAAAGAGAATTTCA18907897TTCATTGACAACATTTTGTAAAATTATTTTATTTATTTATTTTAC
Canis lupus familiaris breed Labrador retriever chromosome 02a.
CP050574.1:29563037-29563051
ATAATCAAAAATAACACTGCAACAGTGCAG29563037TTCATTGACAACATTTGCTTTCCAATCGTGCCAACTAAGAAAAAA
Canis lupus familiaris breed Labrador retriever chromosome 12a.
CP050578.1:36247219-36247233
ATTGAGGCCAGAGCTCCGTCCTGAATTAGG36247219TTCATTGACAACATTCCCTTACCACACTCTTTCTCAGACTTTAAG
Canis lupus familiaris breed Labrador retriever chromosome 33a.
CP050594.1:24913541-24913555
TTCTGAGAATTTAATGGAAAACATGATGAC24913541TTCATTGACAACATTGCAATGTATAATTGAAATTTGCTAAGAGAG
Canis lupus familiaris breed Labrador retriever chromosome 05a.
CP050595.1:75367501-75367515
AACTATGATTTTTTCCTTTGAAATCTATTT75367501TTCATTGACAACATTTATCCCTTATCTTCTCTCTCCAATTGTGAG
Canis lupus familiaris breed Labrador retriever chromosome 03a.
CP050599.1:17335517-17335531
CATGATCACAATCTGAGTCATGTAATTGAG17335517TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCACTGTTC
Canis lupus familiaris breed Labrador retriever chromosome 02b.
CP050613.1:29585355-29585369
ATAATCAAAAATAACACTGCAACAGTGCAG29585355TTCATTGACAACATTTGCTTTCCAATCGTGCCAACTAAGAAAAAA
Canis lupus familiaris breed Labrador retriever chromosome 12b.
CP050616.1:36256894-36256908
ATTGAGGCCAGAGCTCCGTCCTGAATTAGG36256894TTCATTGACAACATTCCCTTACCACACTCTTTCTCAGACTTTAAG
Canis lupus familiaris breed Labrador retriever chromosome 33b.
CP050619.1:24901170-24901184
TTCTGAGAATTTAATGGAAAACATGATGAC24901170TTCATTGACAACATTGCAATGTATAATTGAAATTTGCTAAGAGAG
Canis lupus familiaris breed Labrador retriever chromosome 15b.
CP050620.1:47173247-47173261
TAGAATATATTATCACTTTAAACACAGATT47173247TTCATTGACAACATTCTGTGGGCATCCATTTAATATTAATATTAA
Canis lupus familiaris breed Labrador retriever chromosome 04b.
CP050625.1:18905620-18905634
AATAAATTGAAAAGGACAAAGAGAATTTCA18905620TTCATTGACAACATTTTGTAAAATTATTTTATTTATTTATTTTAC
Canis lupus familiaris breed Labrador retriever chromosome 03b.
CP050627.1:17310945-17310959
CATGATCACAATCTGAGTCATGTAATTGAG17310945TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCACTGTTC
Canis lupus familiaris breed Labrador retriever chromosome 20b.
CP050631.1:25999722-25999736
AGTCGACAACAAAAGCACTATCTGTGTTGT25999722TTCATTGACAACATTTCTGAAGTGGCCATTTATCTCTCACAGCAA
Canis lupus familiaris breed Labrador retriever chromosome 05b.
CP050642.1:75365232-75365246
AACTATGATTTTTTCCTTTGAAATCTATTT75365232TTCATTGACAACATTTATCCCTTATCTTCTCTCTCCAATTGTGAG
Sus scrofa BAC clone CHORI242_269D21_Contig29.
FN677168.1:27486-27500
ATTAGGTAAAGCACTACTACGTAGGTCTGT27486TTCATTGACAACATTCCAGATTCTGTTGTGCTGGGCTCTCACAAT
Sarcophilus harrisii genome assembly, chromosome: 1.
LR735554.1:210081639-210081653
CATGATAACAATTTGAGTCATGTAATTGAG210081639TTCATTGACAACATTTAGATAATCCATAGCACGCTTCCACTGATC
Sarcophilus harrisii genome assembly, chromosome: 1.
LR735554.1:266868615-266868629
GTTCTATCCAAATTTACCTACTTATTACTC266868615TTCATTGACAACATTTTCTTTCCCATCTCATTGCTTTTGCACAGG
Sarcophilus harrisii genome assembly, chromosome: 1.
LR735554.1:351600817-351600831
GGAAAAACAAAGCAACTTTTCCTATGTCTC351600817TTCATTGACAACATTGTTTACTATTAAAGAATAAACAAGATCAGG
Sarcophilus harrisii genome assembly, chromosome: 1.
LR735554.1:355007507-355007521
ACATTGGCCTTCTTGTTACTCTTCATGTTT355007507TTCATTGACAACATTATATCTTCTGATTACCTGATCATATACCTG
Sarcophilus harrisii genome assembly, chromosome: 1.
LR735554.1:636049531-636049545
GTATTGTTATATAAAGTCTTCTTCTGTAGG636049531TTCATTGACAACATTTTTGTAGCAAATCTAGCAGTAGAGAAAACA
Sarcophilus harrisii genome assembly, chromosome: 2.
LR735555.1:172002722-172002736
AAAATGTCAACAAACAAAAGCCATGTACTA172002722TTCATTGACAACATTACAGTATAGACTTCCTTCTTTCTATATAGT
Sarcophilus harrisii genome assembly, chromosome: 2.
LR735555.1:329864152-329864166
TCTATCTAGTTTCTGGACTGCTTTTCAGTT329864152TTCATTGACAACATTTTCTTTTCTTTTCTTCTTTTTTTTTCTGAG
Sarcophilus harrisii genome assembly, chromosome: 2.
LR735555.1:444767350-444767364
AAGTTTGACTAGATGACTTCTGAGGTCCAT444767350TTCATTGACAACATTCTATGTTCTATGTTCTTTCATTCTGAATTC
Sarcophilus harrisii genome assembly, chromosome: 3.
LR735556.1:101681680-101681694
GATATGTTTGTATTTAGCCTGAGAAGATAG101681680TTCATTGACAACATTTGGAATTTCCCTAATCTTATATGTAAGTGA
Sarcophilus harrisii genome assembly, chromosome: 3.
LR735556.1:363283900-363283914
GTTCCATAAAGGAAGATTAATTTACTTTAC363283900TTCATTGACAACATTGGTGAAAATCTTCCTTTTCACCAGTGTTGT
Sarcophilus harrisii genome assembly, chromosome: 3.
LR735556.1:367694303-367694317
TTAATTAACTTAAAAACATGATTTTGATAG367694303TTCATTGACAACATTAGACTTACAAAGCAATCCATTGCACACAGA
Sarcophilus harrisii genome assembly, chromosome: 4.
LR735557.1:438018990-438019004
TCCTCGGTGAAGTACGACTCAGAGAAGCAC438018990TTCATTGACAACATTTACATGCCGGTGGGGCTGGCGGTCTCCTCC
Sarcophilus harrisii genome assembly, chromosome: 5.
LR735558.1:205857786-205857800
CACCAGCATCCGCATCGGATTACTAACTTT205857786TTCATTGACAACATTTTGCGGCCAGAGTTCGGCCGAAGAAAGGAA
Sarcophilus harrisii genome assembly, chromosome: 5.
LR735558.1:238363333-238363347
AAGCTACAGGGAAATGAAGAAGGCTGAAGA238363333TTCATTGACAACATTGGAAAGAGCAGTTTTAGTTGAATGTTAAGA
Sarcophilus harrisii genome assembly, chromosome: 6.
LR735559.1:45383023-45383037
TATATGCATACAAATACTTAATGAAGAATA45383023TTCATTGACAACATTTTATAGTAATTTTAAGAAGTCACATTTAAA
Lutra lutra genome assembly, chromosome: 1.
LR738403.1:197863484-197863498
AGTATGCTGCACTCCAAATACTATTGTGTT197863484TTCATTGACAACATTCACTATTACATATGCATATGAAAAACAGGC
Lutra lutra genome assembly, chromosome: 2.
LR738404.1:65154340-65154354
TAGAATATATTATCACTTTAAACACAGATT65154340TTCATTGACAACATTCTGTGGGCATCCATTTAATATTAATATTAA
Lutra lutra genome assembly, chromosome: 2.
LR738404.1:74333315-74333329
ATACATATGAAAGACATAAGGAGCATATAT74333315TTCATTGACAACATTTTACCAGGTTCATCTACTGTATTCAAATAC
Lutra lutra genome assembly, chromosome: 3.
LR738405.1:25621639-25621653
ATGGTTTTTGTTCAATTAACGTGAAGCTCT25621639TTCATTGACAACATTTCGTTCATCCTTTAAGAGCAAAATATCCTC
Cyprinus carpio mRNA for ATP synthase beta-subunit, complete cds.
AB023582.1:889-903
CGTGACCAGGAGGGGCAGGATGTGCTGCTA889TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
Chrysemys picta BAC clone CHY3-119H12 from chromosome unknown, complete sequence.
AC239498.2:19046-19060
ATGGAATGAGAATATAGAAAGGAGTAACAC19046TTCATTGACAACATTAGCTTCTATATGCCTCCATAAGACTTGTTT
Epinephelus fuscoguttatus DNA, LG6, complete sequence.
AP022680.1:18681664-18681678
GCTGAACCCAGCTTTCTCAGTCAATATGCC18681664TTCATTGACAACATTTACCAACAACACTGACTGGACATCCACATA
Epinephelus fuscoguttatus DNA, LG6, complete sequence.
AP022680.1:23920885-23920899
TTAATGTGTTTTTATATATCATGAAAGGCA23920885TTCATTGACAACATTGACTCCTACATCCTACTATTTTTTGTTTAT
Epinephelus fuscoguttatus DNA, LG8, complete sequence.
AP022682.1:45898206-45898220
TGACTCACAATCAATGACACAGAGAAGTCT45898206TTCATTGACAACATTGGTGACATAGTGCAGGACTACAGCGCACTG
Epinephelus fuscoguttatus DNA, LG12, complete sequence.
AP022686.1:11984550-11984564
AGTTAATTAAAAACAAGGTTCCTGTCGTTA11984550TTCATTGACAACATTTCAACATTTGAAACCTTTTCTATATATATA
Epinephelus fuscoguttatus DNA, LG13, complete sequence.
AP022687.1:11284240-11284254
ATAACATCTAACAAGTCTCAACAGCTGCTT11284240TTCATTGACAACATTTATAAACAAATGTCAGTGAACAGAACCTAA
Epinephelus fuscoguttatus DNA, LG13, complete sequence.
AP022687.1:15452939-15452953
GTTTCATGTCGCTTTTCTCTTCTTACTGCC15452939TTCATTGACAACATTATCTTTTGTTGTATTATTTTTGGACAAGCC
Plectropomus leopardus DNA, chromosome 2, nearly complete sequence.
AP022701.1:35803699-35803713
ACAGAGAAAACATAACATGACATTAACACA35803699TTCATTGACAACATTTAACATAGAAGGGGATATATAGTCATGCAA
Plectropomus leopardus DNA, chromosome 11, nearly complete sequence.
AP022710.1:1063900-1063914
GGCCAGCAGGCCCACAGAACCACCAACTTT1063900TTCATTGACAACATTTTGCGGCCGGACTTCGGCTGTAAGAAGGAG
Plectropomus leopardus DNA, chromosome 11, nearly complete sequence.
AP022710.1:6617018-6617032
ACAGAGAAAACATAACATGACATTAACTCG6617018TTCATTGACAACATTTAACACAGAATGGGATATATAGTTCATGCA
Plectropomus leopardus DNA, chromosome 12, nearly complete sequence.
AP022711.1:24777690-24777704
ATAAAAGTTTAAACACTGTTTCCACACATT24777690TTCATTGACAACATTTCAAAACTTTTCTATGACTTTTAAAGGAAC
Plectropomus leopardus DNA, chromosome 15, nearly complete sequence.
AP022714.1:9026144-9026158
CTAAGTCTTACCACAGGGTTTCCACATATT9026144TTCATTGACAACATTTCAAAACTCTACATGATTTTGATGGCCACT
Plectropomus leopardus DNA, chromosome 19, nearly complete sequence.
AP022718.1:23480150-23480164
GTTTCGGGGGCACCAAAGACAAATAAGCCA23480150TTCATTGACAACATTGTAACTGTGCAAATGAGCTAATAAAGCATG
Plectropomus leopardus DNA, chromosome 20, nearly complete sequence.
AP022719.1:14085340-14085354
TTAAGTAATTGCTCAGGGTTTCCACACATT14085340TTCATTGACAACATTTCCAAACTTTTCCATGACTTTTCAAGGACC
Plectropomus leopardus DNA, chromosome 22, nearly complete sequence.
AP022721.1:23831816-23831830
GCAGCAAACATAATGATAAAAATAAAGATC23831816TTCATTGACAACATTATCTGAAAAAACAAATCACATTTAGTAGAT
Plectropomus leopardus DNA, chromosome 23, nearly complete sequence.
AP022722.1:11428485-11428499
TGTGATTTTCTGCAGTTTTCTCATCTGTAA11428485TTCATTGACAACATTATAAAAACTGATTTACTATATGCCTATATA
Xenopus laevis ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit, mRNA (cDNA clone MGC:53838 IMAGE:5542544), complete cds.
BC046741.1:929-943
AGAGATCAAGAGGGACAAGATGTGTTGCTT929TTCATTGACAACATTTTCAGGTTCACCCAGGCTGGTTCAGAGGTG
Xenopus laevis engrailed homolog 2, mRNA (cDNA clone MGC:196517 IMAGE:9041424), complete cds.
BC169790.1:556-570
CACCAGCCCCATCACAGGATAACGAACTTC556TTCATTGACAACATTCTACGGCCGGAGTTCGGGAGGAGGAAAGAA
Xenopus laevis engrailed homolog 2, mRNA (cDNA clone MGC:196519 IMAGE:9041426), complete cds.
BC169792.1:556-570
CACCAGCCCCATCACAGGATAACGAACTTC556TTCATTGACAACATTCTACGGCCGGAGTTCGGGAGGAGGAAAGAA
Zebrafish DNA sequence from clone DKEYP-95B12 in linkage group 16.
BX323565.10:39334-39348
GTTTGAGATATAGGCCTATGCTTACAATCT39334TTCATTGACAACATTATAAGACCATTTAATTCACTGGTAAAATCA
Zebrafish DNA sequence from clone DKEY-84I7 in linkage group 5.
BX465199.9:115149-115163
TTATAAAGTTGATTTATGTGCTTGTCATCT115149TTCATTGACAACATTATTAAACCATTAGTTTTCACTGGAAAAATG
Zebrafish DNA sequence from clone CH211-63C23 in linkage group 10.
BX470204.13:1023-1037
GAAGGAGAGAATGCCAACAACTTTCCTCGG1023TTCATTGACAACATTACTGAACAACAACAAGTAAGGGTCTTAAAG
Oryzias latipes strain HSOK chromosome 22.
CP020642.1:15937799-15937813
TGGTTCAAAACATTCACAGTAATCTGCAGA15937799TTCATTGACAACATTGGTTGTTTGAATTCAGTCTTTGTTTTTTTT
Oryzias latipes strain Hd-rR chromosome 4 sequence.
CP020668.1:5325988-5326002
AATGTGGCAGATCTGAAGGATGTTGTGGAG5325988TTCATTGACAACATTTCTTGGAGCATTAAAAACATATACCAGTAA
Oryzias latipes strain Hd-rR chromosome 22 sequence.
CP020686.1:15802857-15802871
TGGCTCAAAACATTGACAGTTATCTGCAGA15802857TTCATTGACAACATTGGTTGTTTGAATTCAGTCTTTGTTTTTTTT
Oryzias latipes strain HNI chromosome 11.
CP020789.1:24909480-24909494
TTCAGTCCAAACACCAAAGCATCTAATGGT24909480TTCATTGACAACATTACATTGAAATAGCCTATATTTCGTGTCAGC
Oryzias latipes strain HNI chromosome 18.
CP020796.1:12015481-12015495
AGTAGGGACAGTGTTCTTTTCGTTGTATGC12015481TTCATTGACAACATTTTGTAATCAGTTAAGTTTTACAACCACAAA
Oryzias latipes strain HNI chromosome 22.
CP020800.1:15336640-15336654
TGGTTCAAAACATTGACAGTTATCTGCAGA15336640TTCATTGACAACATTGGTTGTTTGAATTCAGTCTTTGTTTTTTTT
Scophthalmus maximus chromosome 8.
CP026250.1:11077150-11077164
AACATTTAATGACTTGGCAGACACACTGTG11077150TTCATTGACAACATTCCCTTATCATAATAAAAAACATAATCAAGA
Scophthalmus maximus chromosome 11.
CP026253.1:21021428-21021442
CCATAGACTGAAGTGTATTTGATTGATTCA21021428TTCATTGACAACATTAACAAAAGAAACGTTTCAAATATATCGTGA
Lateolabrax maculatus chromosome Lm8.
CP027269.1:14183985-14183999
GAATATGTGCAATGCGATGTGATCTTTCAT14183985TTCATTGACAACATTTATTTTGCACATAATTCCACGTCCTCCATT
Lateolabrax maculatus chromosome Lm18.
CP027279.1:4723976-4723990
CACATAAAAGGCAATCAAAACAGGACGAGG4723976TTCATTGACAACATTTGTTTGATGCCGTTACATAAATCCAAACAA
Lateolabrax maculatus chromosome Lm18.
CP027279.1:15067407-15067421
ACAGTAAACATACAACACCATAGGCGTTTT15067407TTCATTGACAACATTGCCAAGATTCAATTTAACTGGGGGAAAATA
Lateolabrax maculatus chromosome Lm23.
CP027284.1:6245923-6245937
TAAATAAAGGCCTGACTCTCTTTGGTTTTG6245923TTCATTGACAACATTATAATATATTTATAAAATACAACATATCAG
Lateolabrax maculatus chromosome Lm23.
CP027284.1:6246316-6246330
TAAATAAAGGCCTGACTCTCTTTGGTTTTG6246316TTCATTGACAACATTATAATATATTTATAAAATACAACATATCAG
Lateolabrax maculatus linkage group 1 sequence.
CP032584.1:6802737-6802751
TAAATAAAGGCCTGACTCTCTTTGGTTTTG6802737TTCATTGACAACATTATAATATATTTATAAAATACAACATATCAG
Lateolabrax maculatus linkage group 12 sequence.
CP032586.1:7745959-7745973
CAGTATCAACATTTTGTGACTTGCCAGACA7745959TTCATTGACAACATTTCCTCAGTATGTTAGTCAACAAATTCTATG
Zebrafish DNA sequence from clone CH211-282F6 in linkage group 3.
CR812464.10:100630-100644
GCGTCTGTTGTGGCGAAACTGTTGTCCTGC100630TTCATTGACAACATTGTATGACCTTGGCTTATTTCGTTTTGAAAC
Zebrafish DNA sequence from clone CH211-237A4 in linkage group 4.
CR812471.13:29589-29603
GCGTCTGTTGCGGCGAAACTGTTGTCCTGC29589TTCATTGACAACATTGTATGACCTTGGCTCATTTCTTTTTGAAAC
Zebrafish DNA sequence from clone CH73-241F5 in linkage group 2.
CU694255.9:47445-47459
GCGTCTGTTGCGGCGAAACTGTTGTCCTGC47445TTCATTGACAACATTGTATGACCTTGGCTCATTTCTTTTTGAAAC
Zebrafish DNA sequence from clone CH73-78K15 in linkage group 1.
CU929244.6:32740-32754
CGGAGCGCAGGTTGAGATCTCCTTGCTGGT32740TTCATTGACAACATTTCCGGCAGAAGCCTAGCTTTTCCCATGTGG
Channa striata mitochondrial ATP synthase subunit beta mRNA, partial cds; nuclear gene for mitochondrial product.
JX644440.1:388-402
CGTGACCAGGAGGGTCAGGATGTGCTGCTC388TTCATTGACAACATTTTCCGGTTCACACAGGCTGGCTCTGAGGTG
Hypophthalmichthys nobilis ATP synthase, H+ transporting, mitochondrial F1 complex, beta subunit mRNA, complete cds; nuclear gene for mitochondrial product.
KF179068.1:905-919
CGTGACCAGGAGGGGCAGGATGTGCTGCTC905TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGGTCAGAGGTG
Hypophthalmichthys molitrix ATP synthase, H+ transporting, mitochondrial F1 complex, beta subunit mRNA, complete cds; nuclear gene for mitochondrial product.
KF179070.1:905-919
CGTGACCAGGAGGGGCAGGATGTGCTGCTC905TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
Xenopus laevis atp5b.S mRNA for ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide, partial cds, clone: XLap_atp5b-S.
LC315598.1:564-578
AGAGATCAAGAGGGACAAGATGTGTTGCTT564TTCATTGACAACATTTTCAGGTTCACCCAGGCTGGTTCAGAGGTG
Apteryx australis mantelli genome assembly, scaffold: scaffold31.
LK064661.1:11998661-11998675
GGCTTGCTAGAATGAAGCTGCCTTTTTAAG11998661TTCATTGACAACATTAAACAACCTTCTTGAGTGTTTATTGTGAAA
Apteryx australis mantelli genome assembly, scaffold: scaffold7.
LK064712.1:1170596-1170610
GTCTAGCATAATTATCAAGCTTAGCTGCGT1170596TTCATTGACAACATTCTATCTAACCTGGTGAGGTAATTTTAGCTT
Apteryx australis mantelli genome assembly, scaffold: scaffold7.
LK064712.1:8260848-8260862
AGTTGAAATCACACAACAAAGTTTCGCTGT8260848TTCATTGACAACATTCTTTAAGAAGCAATTGTCAGCAGACAAATG
Apteryx australis mantelli genome assembly, scaffold: scaffold178.
LK064747.1:430179-430193
CTCGGAGATCCCTTCTCACCATGGGAAGAC430179TTCATTGACAACATTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
Drosophila melanogaster 3L BAC RPCI98-25O1 (Roswell Park Cancer Institute Drosophila BAC library) complete sequence.
AC010066.9:82672-82686
CGCGACGTGGACGGGCAGGATGTGCTGCTC82672TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Daphnia pulex clone JGIAZSN-5K3, complete sequence.
AC167686.2:16544-16558
AAGTCGAAAAAGATTGAGACGAAACATCAT16544TTCATTGACAACATTTGCCCATAGGGTGTAATAATACGCTACGTT
Trichinella spiralis BAC clone TS195-2H12 from chromosome unknown, complete sequence.
AC189676.2:51234-51248
ACCAACTTTATTCAATATATAATTAGCCAT51234TTCATTGACAACATTGCCAAGATGAACTTCTATCTGAAGTAGAGA
Drosophila melanogaster chromosome 3L.
AE014296.5:16099164-16099178
CGCGACGTGGACGGGCAGGATGTGCTGCTC16099164TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Eurypelma californicum mRNA for hemocyanin subunit f (hcF gene).
AJ277491.1:1160-1174
AGGGATCCGATCTTCTACAGGTACCATCGA1160TTCATTGACAACATTTTCCAGGAGTACAAGGCAACTCTTCCATGC
Thelaxes suberi partial atpD gene for ATPase beta subunit.
AJ296761.1:271-285
AGAGATCAAGAAGGTCAAGATGTATTACTT271TTCATTGACAACATTTTCCGTTTTACTCAAGCTGGTTCTGAAGTA
Panaphis juglandis partial atpD gene for ATPase beta subunit.
AJ296762.1:271-285
AGAGATCAAGAAGGACAGGATGTATTGCTT271TTCATTGACAACATTTTCCGTTTTGCTCAAGCCTGGTCCGAAGTG
Toxoplasma gondii RH strain tachyzoite stage cDNA clone: XTG02692, full cDNA, Sugano cDNA library.
AK223658.1:1012-1026
ATAACATCTGCCCAACACATCTGACATTCC1012TTCATTGACAACATTTCTAGAGACCCGATATCCTTACACAAAACA
Bombyx mori mRNA, clone: fphe23C21.
AK386151.1:931-945
CGTGATCAAGAAGGACAGGATGTACTGCTC931TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
Papilio xuthus mRNA for ATP synthase-beta, complete cds, sequence id: Px-0234.
AK401213.1:940-954
CGTGACCAGGAGGGTCAGGATGTGCTGCTC940TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCTGAAGTG
Papilio polytes mRNA for ATP synthase-beta, complete cds, sequence id: Pp-0189.
AK402408.1:928-942
CGTGATCAGGAGGGTCAGGATGTACTGCTC928TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAAGTG
Papilio polytes mRNA for ATP synthase-beta, complete cds, sequence id: Pp-0315.
AK402480.1:964-978
CGTGATCAGGAGGGTCAGGATGTACTGCTC964TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
Riptortus pedestris mRNA for ATP synthase-beta, complete cds, sequence id: Rped-0378.
AK417201.1:938-952
CGTGACCAAGAAGGACAAGATGTACTGCTT938TTCATTGACAACATTTTCAGATTCACCCAGGCTGGTTCAGAGGTA
Toxoplasma gondii RH, genomic DNA chromosome Ib.
AM055943.1:74489-74503
ATAACATCTGCCCAACACATCTGACATTCC74489TTCATTGACAACATTTCTAGAGACCCGATATCCTTACACAAAACA
Caenorhabditis sp. 34 TK-2017 DNA. chromosome 5, nearly complete genome.
AP018155.1:7438608-7438622
TTTCCACATTTTCAAAGAAGTCGTTCTGTT7438608TTCATTGACAACATTCTTCACAATTTTGATTCTTATTTTGAGTTT
Drosophila melanogaster AT04467 full insert cDNA.
AY089257.1:1112-1126
CGCGACGTGGACGGGCAGGATGTGCTGCTC1112TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Sarcophaga crassipalpis putative ATP synthase-beta subunit mRNA, partial cds; nuclear gene for mitochondrial product.
AY309458.1:28-42
GATCAAGAAGGCCAAGATGTATTGCTT28TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTA
Chaetopterus sp. KJP-2000 ATP synthase beta subunit mRNA, partial cds.
AY580182.1:679-693
CGTGACCACGAGGGTCAGGACGTGCTGCTT679TTCATTGACAACATTTTCCGTTTCACACAGGCTGGCTCTGAGGTG
Enallagma aspersum ATP synthase beta subunit mRNA, partial cds.
AY580209.1:556-570
CGTGATCAGGAAGGACAGGATGTGCTGCTT556TTCATTGACAACATTTTCAGGTTCACCCAAGCTGGTTCAGAGGTG
Lestes congener ATP synthase beta subunit mRNA, partial cds.
AY580223.1:556-570
CGTGATCAGGAGGGTCAGGATGTGCTGCTC556TTCATTGACAACATTTTCAGATTCACTCAGGCTGGTTCAGAGGTG
Monosiga brevicollis ATP synthase beta subunit mRNA, partial cds.
AY580306.1:673-687
TTCCGTGACCAGGGCCGTGACGTGCTTCTC673TTCATTGACAACATTTTCCGTTTCACCCAGGACGGTTCGGAAGTG
Drosophila busckii chromosome X sequence.
CP012528.1:10183298-10183312
ATTAATACACAAATTAGTAAAAAACACAAC10183298TTCATTGACAACATTAAATGCGCAGCCAGCTAAACTTTGAACAAT
Drosophila melanogaster strain sitter (fors) chromosome 3L.
CP023331.1:16092255-16092269
CGCGACGTGGACGGGCAGGATGTGCTGCTC16092255TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain rover (forR) chromosome 3L.
CP023337.1:16092216-16092230
CGCGACGTGGACGGGCAGGATGTGCTGCTC16092216TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Haemonchus contortus strain NZ_Hco_NP chromosome 3.
CP035802.1:13080752-13080766
CGAGACAAAGAAGGACAGGATGTGCTTCTC13080752TTCATTGACAACATTTTCCGTTTCACACAGGCTGGTTCTGAAGTA
Haemonchus contortus strain NZ_Hco_NP chromosome 5.
CP035803.1:9618307-9618321
TAAGGGACCATATTATCCATATCAATAAAA9618307TTCATTGACAACATTCCACTACGAATTGTGTCTTTAGGTTCGACT
Haemonchus contortus strain NZ_Hco_NP chromosome 4.
CP035804.1:73340120-73340134
CTTTCCAGTTGATGCAGCTCGAATAGCAGC73340120TTCATTGACAACATTAGATATATCAGCACCTACGATTTAAGAGCG
Caenorhabditis elegans strain CB4856 chromosome III.
CP038189.1:5492222-5492236
CGTGACCAGGAAGGACAAGATGTGCTTCTT5492222TTCATTGACAACATTTTCCGTTTCACCCAGGCTGGATCTGAAGTG
Caligus rogercresseyi isolate FCH chromosome 4.
CP045893.1:6967402-6967416
TCCTAGGTCAATTAGAAGTTTGATAATCTA6967402TTCATTGACAACATTCAAAGTACAGCTCTTGAAGCTCCGAGAACT
Caligus rogercresseyi isolate FCH chromosome 16.
CP045905.1:12033418-12033432
AGCCATAAATTTGAAATGATTCATTTCTCC12033418TTCATTGACAACATTCTCTACAAGTTAACATTCTACTACTAAAGG
Crassostrea gigas strain QD chromosome 2.
CP048840.1:3784390-3784404
CAAAAACATTGCCTGACTAAAAAAATTTTT3784390TTCATTGACAACATTTATCAATTATTTTGTAAGAAATAAATCTGA
Crassostrea gigas strain QD chromosome 3.
CP048841.1:5395229-5395243
TCTTCTTATGAATACTCCAAACATGGTTCA5395229TTCATTGACAACATTGTTATTTTGTTTTTAAGACTAGTCAGGTAT
Crassostrea gigas strain QD chromosome 4.
CP048842.1:27187994-27188008
ACTTTCTGAAAGAAAAATAATGATAATATG27187994TTCATTGACAACATTATTTTAAAATTTTTATTCCTATATATGCAT
Crassostrea gigas strain QD chromosome 6.
CP048844.1:16817205-16817219
TCTTCTTATGAATACTCCAAACATGGTTCA16817205TTCATTGACAACATTGTTATTTGTTTTTAAGACTAGTCAGGTATA
Crassostrea gigas strain QD chromosome 6.
CP048844.1:41366081-41366095
ATTGGCCGAAGCCTTGCTGATATATGTAGC41366081TTCATTGACAACATTTTTACAAAGCGTAATGTTTTTTCACTTCAT
Crassostrea gigas strain QD chromosome 7.
CP048845.1:12643412-12643426
TCTTCTTATGAATACTCCAAACATGGTTCA12643412TTCATTGACAACATTGTTATTTTGTTTTTAAGACTAGTCAGGTAT
Crassostrea gigas strain QD chromosome 8.
CP048846.1:28851584-28851598
TCTTCTTTTAAATACTCCAAACATGGTTCA28851584TTCATTGACAACATTGTTATTTTGTTTTTAAGACTAGTCAGGTAT
Amphiporus angulatus ATP synthase beta subunit mRNA, partial cds.
DQ087438.1:679-693
CGTGACCAGAAGGGACAGGACGTGCTTCTC679TTCATTGACAACATTTTCAGATTCACACAGGCTGGTTCAGAGGTA
Cerebratulus lacteus ATP synthase beta subunit mRNA, partial cds.
DQ087446.1:679-693
CGTGACCAAGAAGGACAAGATGTGCTACTT679TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGTTCAGAGGTA
Nereis vexillosa ATP synthase beta subunit mRNA, partial cds.
DQ087492.1:679-693
CGTGATATAGAGGGACAGGATGTGTTGCTT679TTCATTGACAACATTTTCAGATTCACACAGGCTGGTTCTGAGGTA
Pinctada fucata ATP synthase beta subunit mRNA, complete cds.
DQ358698.1:914-928
CGTGATCAAGAAGGACAGGACGTGCTGCTT914TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCAGAGGTG
Pacifastacus leniusculus F1-ATP synthase beta subunit mRNA, complete cds.
DQ874396.1:917-931
CGTGATCAAGAGGGACAGGATGTGCTGCTC917TTCATTGACAACATTTTCCGTTTCACTCAGGCAGGTTCTGAAGTG
Drosophila melanogaster strain Fr CG5389 gene, partial sequence.
EF388780.1:223-237
CGCGACGTGGACGGGCAGGATGTGCTGCTC223TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain Can CG5389 gene, partial sequence.
EF388781.1:271-285
CGCGACGTGGACGGGCAGGATGTGCTGCTC271TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain Id CG5389 gene, partial sequence.
EF388782.1:275-289
CGCGACGTGGACGGGCAGGATGTGCTGCTC275TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain LA20 CG5389 gene, partial sequence.
EF388783.1:214-228
CGCGACGTGGACGGGCAGGATGTGCTGCTC214TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain OK91 CG5389 gene, partial sequence.
EF388784.1:222-236
CGCGACGTGGACGGGCAGGATGTGCTGCTC222TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain ZS30 CG5389 gene, partial sequence.
EF388785.1:270-284
CGCGACGTGGACGGGCAGGATGTGCTGCTC270TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain ZS56 CG5389 gene, partial sequence.
EF388786.1:216-230
CGCGACGTGGACGGGCAGGATGTGCTGCTC216TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain ZS8 CG5389 gene, partial sequence.
EF388787.1:269-283
CGCGACGTGGACGGGCAGGATGTGCTGCTC269TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Pedinophyceae sp. YPF-701 chloroplast AtpB gene for ATP synthase CF1 beta subunit, partial cds.
AB561013.1:347-361
CGTGACGTAAACAAGCAAGACGTTCTTTTA347TTCATTGACAACATTTTCCGTTTCGTACAAGCGGGTTCAGAAGTA
Oryza sativa chromosome 10 clone OSJNBa0087H07, complete sequence.
AC074283.3:87092-87106
ACAAATATATTCACAATATTGATTCACAGG87092TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Oryza sativa chromosome 3 BAC OSJNBa0044H10 genomic sequence, complete sequence.
AC084405.6:75548-75562
TGATCCCAATAGTTGTTTATTTTTGGACTC75548TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
Medicago truncatula clone mth2-21k24, complete sequence.
AC121235.20:105578-105592
CTTTAACTCCCTTCAAAATATGAATCAAAC105578TTCATTGACAACATTTATTGTAGCATGTCGAAAATACATGTTTTT
Medicago truncatula clone mth2-36d22, complete sequence.
AC124217.21:23174-23188
ATTAACTTCTTTTCAAAGTCTAAGTCAAAA23174TTCATTGACAACATTTATTATAGCCTATCAAAAATACAGGCTAAC
Oryza sativa Japonica Group chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence.
AC145127.1:2261438-2261452
ACAAATATATTCACAATATTGATTCACAGG2261438TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Cicer arietinum strain FLIP84-92C clone gl1-15o9, complete sequence.
AC145456.1:41857-41871
AGGAATTATGCATTCTGCCATAAACTGCTA41857TTCATTGACAACATTTCCCACATCACTTCCTTAAATTTCCCTACA
Medicago truncatula clone mth2-15m24, complete sequence.
AC148292.9:91765-91779
ATTAACTTCTTTTCAAAGTCTAAGTCAAAA91765TTCATTGACAACATTTATTATAGCCTATCAAAAATACAGGCTAAC
Glycine max strain Williams 82 clone GM_WBb0027P13, complete sequence.
AC235233.1:154767-154781
TTGGATCAATTTTAGCCATTTATACACGAT154767TTCATTGACAACATTGTGGATGTCAAAGCTGATGGTAACTATGGA
Solanum lycopersicum chromosome 3 clone C03HBa0203H10, complete sequence.
AC238462.1:11772-11786
CATTAACCACTAGGCCACACCATTGAGCAC11772TTCATTGACAACATTTACTGATTAAAATTTAATTCAATAAAACAA
Brassica rapa subsp. pekinensis cultivar Inbred line 'Chiifu' clone KBrB022F09, complete sequence.
AC240998.1:80363-80377
CGTGATGCCGAAGGCCAAGATGTGTTGCTT80363TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCCTTTTTGTT
Solanum lycopersicum strain Heinz 1706 chromosome 10 clone hba-7g17 map 10, complete sequence.
AC244076.4:47296-47310
AGAAGTTACCTAAATTCATTTGTCATTGTC47296TTCATTGACAACATTTTGGTATATTCAAAAAATGTGGGTGAACAC
Passiflora edulis clone Pe51C2, complete sequence.
AC278225.1:9003-9017
AAGTATTTCAGAAGTAATAACTAAGATGAC9003TTCATTGACAACATTTTTATCTCAGGGGTTTACATGCCATTGGGG
Ashbya gossypii ATCC 10895 chromosome II, complete sequence.
AE016815.5:720399-720413
AGAGACGAGGAGGGTCAGGATGTGTTGCTG720399TTCATTGACAACATTTTCAGATTCACCCAAGCCGGTTCCGAAGTG
Salvinia molesta ATP synthase beta chain (atpB) gene, partial cds; chloroplast gene for chloroplast product.
AF313552.1:512-526
CGAGATGTCAACAAGCAAGACGTACTCCTA512TTCATTGACAACATTTTTCGTTTCGTCCAAGCGGGATCAGAAGTC
Arabidopsis thaliana mRNA for mitochondrial F1 ATP synthase beta subunit (p_beta gene).
AJ271468.1:1572-1586
CGTGATGCTGAAGGCCAAGACGTTTTGCTT1572TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Oryza sativa Japonica Group cDNA clone:001-037-A03, full insert sequence.
AK061681.1:1029-1043
CGTGATGCCGAAGGACAAGATGTGCTTTTG1029TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Oryza sativa Japonica Group cDNA clone:002-127-D01, full insert sequence.
AK107392.1:1246-1260
GCTCTCTGATCAACACTCTTTTTCGGAACA1246TTCATTGACAACATTCGTCGAGCTGGACTCGACCATGGATTATGG
Oryza sativa Japonica Group cDNA clone:002-153-G05, full insert sequence.
AK108995.1:907-921
CGTGACCAGGAGGGACAGGATGTCTTGCTC907TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Arabidopsis thaliana At5g08670 mRNA for putative H+-transporting ATP synthase beta chain (mitochondrial), complete cds, clone: RAFL19-76-L24.
AK118538.1:1017-1031
CGTGATGCTGAAGGCCAAGACGTTTTGCTT1017TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana At5g08690 mRNA for putative H+-transporting ATP synthase beta chain (mitochondrial), complete cds, clone: RAFL19-82-J07.
AK118582.1:1017-1031
CGTGATGCTGAAGGCCAAGATGTCTTGCTT1017TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv1027K09.
AK355900.1:1834-1848
TTTGGCTCAGGTTTACCCTCTTGCCTATTT1834TTCATTGACAACATTTGTCAGTATATCGCTTCTAATTTTACTCAG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv2010F24.
AK362825.1:829-843
AGAGATGAGGAGGGTAAGGACGTGCTGCTT829TTCATTGACAACATTTTCCGCTTCACCCAAGCTTGCTCAGAGGTG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv3077J11.
AK374834.1:952-966
CGTGACGAGGAGGGTCAGGATGTGCTTCTC952TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Arabidopsis thaliana DNA chromosome 5, BAC clone T2K12 (ESSA project).
AL590346.1:28840-28854
CGTGATGCTGAAGGCCAAGATGTCTTGCTT28840TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Azolla pinnata chloroplast partial atpB gene for putative beta subunit of chloroplast ATP synthase, specimen voucher Schneider s.n. (GOET).
AM176622.1:512-526
CGAGATGTCAACAAGCAAGATGTACTTCCA512TTCATTGACAACATTTTTCGGTTCGTCCAAGCGGGATCAGAAGTC
Salvinia oblongifolia chloroplast partial atpB gene for putative beta subunit of chloroplast ATP synthase, specimen voucher Unknown.
AM176624.1:477-491
CGAGATGTCAACAAGCAAGACGTACTTCTA477TTCATTGACAACATTTTTCGTTTCGTCCAAGCGGGATCAGAAGTC
Vitis vinifera, whole genome shotgun sequence, contig VV78X040248.2, clone ENTAV 115.
AM460727.1:42408-42422
AACAACCAAACAGGTCCTAAACCTCTCACT42408TTCATTGACAACATTATATCCTCAGGTCTTATTCTCTACCATTGT
Vitis vinifera contig VV78X024264.3, whole genome shotgun sequence.
AM482307.1:596-610
TCTTTAAATGGAACAAAATACTATATTCAT596TTCATTGACAACATTATCTTAATGTATTCGGATGATAGGGAAGAC
Oryza sativa Japonica Group genomic DNA, chromosome 7, PAC clone:P0453E05.
AP004275.3:32147-32161
AGATCTATCTAATTTAGGTGTAGTGCTCTC32147TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
Oryza sativa Japonica Group genomic DNA, chromosome 7, PAC clone:P0492E07.
AP004305.3:26834-26848
CGTGTGCCTCCTGGATGCACCAATCGGCTG26834TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
Oryza sativa Japonica Group genomic DNA, chromosome 9, PAC clone:P0556H01.
AP005424.3:30622-30636
CTTTCAAATGATGGTCAAACTAATTATAAA30622TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Oryza sativa Japonica Group genomic DNA, chromosome 9, BAC clone:OJ1328_D07.
AP005833.2:126234-126248
CTTTCAAATGATGGTCAAACTAATTATAAA126234TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Aspergillus oryzae RIB40 DNA, SC010.
AP007175.1:1292143-1292157
CGTGACGAGGAAGGTCAGGATGTGCTGCTC1292143TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Oryza sativa Japonica Group DNA, chromosome 3, cultivar: Nipponbare, complete sequence.
AP014959.1:9682664-9682678
TGATCCCAATAGTTGTTTATTTTTGGACTC9682664TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
Oryza sativa Japonica Group DNA, chromosome 7, cultivar: Nipponbare, complete sequence.
AP014963.1:12705943-12705957
CGTGTGCCTCCTGGATGCACCAATCGGCTG12705943TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
Oryza sativa Japonica Group DNA, chromosome 7, cultivar: Nipponbare, complete sequence.
AP014963.1:24274176-24274190
AGATCTATCTAATTTAGGTGTAGTGCTCTC24274176TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
Oryza sativa Japonica Group DNA, chromosome 9, cultivar: Nipponbare, complete sequence.
AP014965.1:16180672-16180686
CTTTCAAATGATGGTCAAACTAATTATAAA16180672TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Oryza sativa Japonica Group DNA, chromosome 10, cultivar: Nipponbare, complete sequence.
AP014966.1:2282429-2282443
ACAAATATATTCACAATATTGATTCACAGG2282429TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Vigna angularis var. angularis DNA, chromosome 2, almost complete sequence, cultivar: Shumari.
AP015035.1:2763351-2763365
GTGTATCAATTAAATCTATTCCGTCAATTT2763351TTCATTGACAACATTAATTGTGTGGTTATGTAGCAAAAGAGTGTA
Vigna angularis var. angularis DNA, chromosome 4, almost complete sequence, cultivar: Shumari.
AP015037.1:17743347-17743361
TCCTCAAGTTGGAAGTTCTTACGCGTATTT17743347TTCATTGACAACATTATTTACTAGAGGTCCTTCACCATTTAGTGT
Vigna angularis var. angularis DNA, chromosome 8, almost complete sequence, cultivar: Shumari.
AP015041.1:3253525-3253539
TATATTTAGGTTTGCAGAATTATAGATGAA3253525TTCATTGACAACATTTGCAATGTTGGTGACCACTTGCTTACTTTG
Prunus dulcis DNA, pseudomolecule Pd03.
AP019299.1:15714560-15714574
GGGTTTTGATGCCAAGCCACGTGTGAGGCT15714560TTCATTGACAACATTTTCTTGCATTAAAAAATTCTAAGGGGACAA
Prunus dulcis DNA, pseudomolecule Pd04.
AP019300.1:4537392-4537406
AATATAGTAGATGAAGGTTGAATCTGGATT4537392TTCATTGACAACATTCAGAAAGGGGTGTATTTGAATAAAAAAGTT
Prunus dulcis DNA, pseudomolecule Pd04.
AP019300.1:6238962-6238976
ATAAGTTTTCTCTGTTCGGTTTAATTATTT6238962TTCATTGACAACATTGGATCATGTTAGAATTTCAAGATAAACAGA
Prunus dulcis DNA, pseudomolecule Pd07.
AP019303.1:11626678-11626692
AACAAACAATTTTAGTAAGTGAAATCTTAA11626678TTCATTGACAACATTCTACAGGAATTTATTAATCTATCTTTCCAG
Marchantia polymorpha subsp. ruderalis Tak-1 DNA, chromosome: 1.
AP019866.1:22155075-22155089
CAAAAAACTATGAATAATTCCATTGATTAT22155075TTCATTGACAACATTGGAGTGATTAGATCACTCAATATAGAATTC
Prunus dulcis DNA, unplaced-scaffold_283.
AP020620.1:8084-8098
GAAGTTTCCCTCTGTTCGGTTTAATTATTT8084TTCATTGACAACATTGGATCATGGTTCCAATTTCAAGAGAAACAA
Lotus japonicus B-129 DNA, chromosome 1, complete sequence.
AP022629.1:45918300-45918314
TTTATAATAGAAGTTTCCTTGAAAAATTTA45918300TTCATTGACAACATTCTTAATTACAGGAGAAACTTGGCTCTATAT
Lotus japonicus B-129 DNA, chromosome 2, complete sequence.
AP022630.1:11714130-11714144
AGACTATTCTTGGACAAGTTCGTGGTGGTG11714130TTCATTGACAACATTCTGATTTACTCGAAGAGAAAAGAGGAACAC
Clostridium acetobutylicum ATCC 824, complete genome.
AE001437.1:2175576-2175590
GGTATTTTATCTTTATTTACAAAAACAGTC2175576TTCATTGACAACATTATTCTCGAAAGTTCTCCTCCTGATACAATT
Bacillus anthracis DNA, nearly complete genome, strain: Shikan-NIID.
AP014833.1:3943298-3943312
ATCGGAACGGTTCCAGCTAACAATACGGTG3943298TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Acinetobacter baumannii ATCC 17978, complete genome.
CP000521.1:1847708-1847722
ATGTTAAGCGATGCACCAGCATTGCAGTCA1847708TTCATTGACAACATTTTGCGCCATGGTCTTGACATCAAGCTTGAA
Chloroherpeton thalassium ATCC 35110, complete genome.
CP001100.1:1592376-1592390
CCTCATGAAGCGGGCAGCGGGATTGAGCAG1592376TTCATTGACAACATTCGCAAGCTCAATTTGCACAATTCCATTTTC
Bacillus cereus H3081.97 plasmid pH308197_258, complete sequence.
CP001166.1:40439-40453
ATAGGAACTGTTCCAGCTAACAACACGGTG40439TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
Bacillus anthracis str. CDC 684, complete genome.
CP001215.1:2712577-2712591
ATCGGAACGGTTCCAGCTAACAATACGGTG2712577TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Pasteurella multocida subsp. multocida str. 3480, complete genome.
CP001409.1:1644073-1644087
CAATTTTAATCTTGTCGCACCTGTCACCAA1644073TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence.
CP001904.1:293982-293996
ATAGGAACTGTTCCAGCTAACAACACGGTG293982TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
Arcobacter nitrofigilis DSM 7299 chromosome, complete genome.
CP001999.1:634479-634493
TTCAAGAACATTATCAAGAACTACTCTTAC634479TTCATTGACAACATTCTTTGTTGTTGCGACTTTATATTTCTTTGG
Thermoanaerobacter mathranii subsp. mathranii str. A3, complete genome.
CP002032.1:695794-695808
ATCCGATATTCTGTTTTTAGTGGATATGGG695794TTCATTGACAACATTTGGAGAAGAAATCGAAAAGGAGTTTGGCAT
Clostridium acetobutylicum EA 2018, complete genome.
CP002118.1:2174984-2174998
GGTATTTTATCTTTATTTACAAAAACAGTC2174984TTCATTGACAACATTATTCTCGAAAGTTCTCCTCCTGATACAATT
Caldicellulosiruptor obsidiansis OB47, complete genome.
CP002164.1:2291756-2291770
GCAGCAACAGAATTGCCTATTATAACATAC2291756TTCATTGACAACATTTCCCCCTTTTTAGACCTCTTTGATTTCAAG
Caldicellulosiruptor owensensis OL, complete genome.
CP002216.1:2207096-2207110
GCAGCAACAGAATTGCCTATTACAACATAC2207096TTCATTGACAACATTTCCCCCTTTTTTACACCTCTTTGATTTCAA
Staphylococcus pseudintermedius HKU10-03, complete genome.
CP002439.1:2478572-2478586
TACTGGTCCTGAGTTCGTCTCCATTTTAAG2478572TTCATTGACAACATTAATCGTTGCTGTTGTAACTGCGCGTAAAGG
Desulfobacca acetoxidans DSM 11109, complete genome.
CP002629.1:1520322-1520336
GTCCTGTGGGTCAGCGCCATTGCCAGCGCC1520322TTCATTGACAACATTCCCTTCACGGCGACCATGCTGCCCATAGTG
Clostridium acetobutylicum DSM 1731, complete genome.
CP002660.1:2177171-2177185
GGTATTTTATCTTTATTTACAAAAACAGTC2177171TTCATTGACAACATTATTCTCGAAAGTTCTCCTCCTGATACAATT
Desulfotomaculum ruminis DSM 2154, complete genome.
CP002780.1:2086166-2086180
ATCACCTCTTTTTTTCAGTAGCGAAATAAC2086166TTCATTGACAACATTCATAAGCTGATCTTCACTGATGCCGCTCTC
Pasteurella multocida 36950, complete genome.
CP003022.1:1630845-1630859
CAATTTTAATCTTGTCGCACCTGTCACCAA1630845TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Anabaena sp. 90 chromosome chANA01, complete sequence.
CP003284.1:260790-260804
GTCTTGAGATTCCCAATTTTTAATAATATA260790TTCATTGACAACATTATCTAACCAAAACTCTTCATAACCTTTAGC
Pasteurella multocida subsp. multocida str. HN06, complete genome.
CP003313.1:1640084-1640098
CAATTTTAATCTTGTCGCACCTGTCACCAA1640084TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Pasteurella multocida subsp. multocida str. HB03, complete genome.
CP003328.1:1577598-1577612
CAATTTTAATCTTGTCGCACCTGTCACCAA1577598TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Bacillus cereus FRI-35 plasmid p01, complete sequence.
CP003748.1:213995-214009
ATAGGAACTGTTCCAGCTAACAATACGGTA213995TTCATTGACAACATTCCAGAAGGGACTATATTCATTGAAGATAGC
Acinetobacter baumannii BJAB07104, complete genome.
CP003846.1:1301692-1301706
ATGTTAAGTGATGCACCAGCATTGCAGTCA1301692TTCATTGACAACATTTTGCGCCATGGTCTTGACATCAAGCTTGAA
Acinetobacter baumannii BJAB0868, complete genome.
CP003849.1:1252910-1252924
ATGTTAAGTGATGCACCAGCATTGCAGTCA1252910TTCATTGACAACATTTTGCGCCATGGTCTTGACATCAAGCTTGAA
Acinetobacter baumannii TYTH-1, complete genome.
CP003856.1:1514136-1514150
ATGTTAAGTGATGCACCAGCATTGCAGTCA1514136TTCATTGACAACATTTTGCGCCATGGTCTTGACATCAAGCTTGAA
Pasteurella multocida OH1905, complete genome.
CP004392.1:1111732-1111746
CAATTTTAATCTTGTCGCACCTGTCACCAA1111732TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Candidatus Thioglobus singularis PS1, complete genome.
CP006911.1:875702-875716
ATGAAAAAAATACTATTAACTTTAAAAAAA875702TTCATTGACAACATTAGAAGTACAATTAACTCTTTTGAGAGATAG
Pasteurella multocida subsp. multocida HB01, complete genome.
CP006976.1:1638989-1639003
CAATTTTAATCTTGTCGCACCTGTCACCAA1638989TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Pasteurella multocida subsp. multocida str. HN07, complete genome.
CP007040.1:1614821-1614835
CAATTTTAATCTTGTCGCACCTGTCACCAA1614821TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Pasteurella multocida subsp. multocida PMTB2.1, complete genome.
CP007205.2:1613041-1613055
CAATTTTAATCTTGTCGCACCTGTCACCAA1613041TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Synechocystis sp. PCC 6714, complete genome.
CP007542.1:2598375-2598389
CGGGACGTCAATAAGCAAGATGTGTTGCTC2598375TTCATTGACAACATTTTCCGTTTCGTCCAAGCTGGTTCAGAAGTG
Staphylococcus capitis subsp. capitis strain AYP1020, complete genome.
CP007601.1:2244465-2244479
CCTCTGTAAGAAGCGGGTAGTACAATAGGC2244465TTCATTGACAACATTGACGTTGAAGTTGGTATTTTAAATTCACTT
Bacillus anthracis strain 2000031021, complete genome.
CP007618.1:2493871-2493885
ATCGGAACGGTTCCAGCTAACAATACGGTG2493871TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain delta Sterne genome.
CP008752.1:3969937-3969951
ATCGGAACGGTTCCAGCTAACAATACGGTG3969937TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Pasteurella multocida strain ATCC 43137, complete genome.
CP008918.1:117936-117950
CAATTTTAATCTTGTCGCACCTGTCACCAA117936TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Paenibacillus sp. FSL H7-0737, complete genome.
CP009279.1:6151569-6151583
CCTGTTCATTTGCGCTTTTTTGCCCGTTCC6151569TTCATTGACAACATTACGTAGCATCATCGTCATTGCCTCTGCGGT
Bacillus cereus D17, complete genome.
CP009300.1:2965749-2965763
ATCGGAACGGTTCCAGCTAACAATACAGTG2965749TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain PAK-1, complete genome.
CP009325.1:3685826-3685840
ATCGGAACGGTTCCAGCTAACAATACGGTG3685826TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain K3, complete genome.
CP009331.1:5150213-5150227
ATCGGAACGGTTCCAGCTAACAATACGGTG5150213TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain SK-102, complete genome.
CP009464.1:4799284-4799298
ATCGGAACGGTTCCAGCTAACAATACGGTG4799284TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain Pasteur, complete genome.
CP009476.1:1233237-1233251
ATCGGAACGGTTCCAGCTAACAATACGGTG1233237TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Methanosarcina vacuolata Z-761, complete genome.
CP009520.1:3962519-3962533
TACCGGAATAATACTGTAATGTTTCATTAC3962519TTCATTGACAACATTTTGATGAATACTTATTTCCTCTTCATCATC
Methanosarcina barkeri str. Wiesmoor, complete genome.
CP009526.1:800853-800867
TACCGGAATAATACTACATTGTTTCATTAC800853TTCATTGACAACATTTTGATGAACATTTATTTCCTCTTCATTATC
Bacillus anthracis str. Sterne, complete genome.
CP009541.1:1099438-1099452
ATCGGAACGGTTCCAGCTAACAATACGGTG1099438TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain BA1015, complete genome.
CP009544.1:3348628-3348642
ATCGGAACGGTTCCAGCTAACAATACGGTG3348628TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus cereus strain 3a plasmid pBFC_3, complete sequence.
CP009595.1:169593-169607
ATAGGAACTGTTCCAGCTAACAACACGGTG169593TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
Bacillus cereus strain 3a, complete genome.
CP009596.1:2066774-2066788
ATCGGAACGGTTCCAGCTAACAATACGTTG2066774TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis str. V770-NP-1R, complete genome.
CP009598.1:3337765-3337779
ATCGGAACGGTTCCAGCTAACAATACGGTG3337765TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus cereus strain S2-8, complete genome.
CP009605.1:2611822-2611836
ATCGGAACGGTTCCAGCTAACAATACGTTG2611822TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence.
CP009606.1:35828-35842
ATAGGAACTGTTCCAGCTAACAACACGGTG35828TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
Human rhinovirus A strain HRV-A80_p1138_sR1041_2009 polyprotein gene, partial cds.
JN798586.1:3474-3488
CATACACTAGGTGAAGCATTTGGTGCTGGC3474TTCATTGACAACATTAAAGACCAGATCCAATCTATTAACCCCATA
Human rhinovirus A strain HRV-A80_p1187_sR2954_2009 polyprotein gene, partial cds.
JN990705.1:3664-3678
CATACACTAGGTGAAGCATTTGGTGCTGGC3664TTCATTGACAACATTAAAGACCAGATCCAATCTATTAACCCCATA
Shearwaterpox virus strain SWPV-1, complete genome.
KX857216.1:82880-82894
AAAGAATACTCTTTTTTTATATTATATACT82880TTCATTGACAACATTTATTAGTGATGTATAGTATTTATATTTTTA
Daphnia iridovirus 1 genome assembly, chromosome: 1.
LS484712.1:126022-126036
TTATTTTGGGATTTGGAAAAATCATTGAGT126022TTCATTGACAACATTGGACCCCTGTGTCTTGAAGACATAAACGTT
Aeromonas phage CF8, complete genome.
MK774614.2:51124-51138
ACACTGGGAATTGAGTTTGGGTATAATCAG51124TTCATTGACAACATTGATCTGATTATTAACTCAGCAGTAGAGCGG
Sequence 3819 from patent US 6902887.
AR674318.1:224-238
CGTGACGAGGAGGGTCAGGACGTGCTGCTC224TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 2351 from patent US 6964868.
AR767803.1:175-189
ATTGTAATAGCCAGAAATTGGAAACATATA175TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Sequence 3881 from patent US 6964868.
AR769332.1:128-142
ATTGTAATAGCCAGAAATTGGAAACATATA128TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Sequence 458 from Patent WO0123604.
AX109725.1:331-345
CGTGACGAGGAGGGTCAGGACGTGCTGCTC331TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 469 from Patent WO0123604.
AX109736.1:687-701
AGAGATGAAGAAGGTCAAGATGTCTTGCTT687TTCATTGACAACATTTTCAGATTCACCCAAGCAGGTTCCGAAGTG
Sequence 475 from Patent WO0123604.
AX109742.1:686-700
AGAGATGAAGAAGGTCAAGATGTCTTGTTG686TTCATTGACAACATTTTCAGATTCACCCAAGCTGGTTCCGAAGTG
Sequence 480 from Patent WO0123604.
AX109747.1:333-347
CGAGACGAGGAGGGTCAGGATGTCTTGTTG333TTCATTGACAACATTTTCCGATTCACCCAAGCCGGTTCCGAAGTG
Sequence 481 from Patent WO0123604.
AX109748.1:261-275
AGAGATGAGGAGGGTCAGGACGTGCTGCTC261TTCATTGACAACATTTTCCGATTCACTCAGGCCGGTTCCGAGGTG
Sequence 484 from Patent WO0123604.
AX109751.1:548-562
CGTGACGACGAGGGCCAGGATGTGCTGCTG548TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCGGAGACT
Sequence 485 from Patent WO0123604.
AX109752.1:677-691
CGTGACGACGAGGGTCAGGATGTGCTGCTC677TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGTTCGGAGACT
Sequence 487 from Patent WO0123604.
AX109754.1:321-335
CGTGACGAGGAAGGTCAGGACGTGCTTCTC321TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
Sequence 494 from Patent WO0123604.
AX109761.1:554-568
AGAGATGAGGAGGGCCAGGATGTCTTGTTG554TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCTGAGGTC
Sequence 678 from Patent WO0123604.
AX109945.1:338-352
CGTGACGAGGAAGGCCAGGATGTGTTGCTT338TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
Sequence 679 from Patent WO0123604.
AX109946.1:336-350
CGTGACGAGGAAGGCCAGGATGTGTTGCTT336TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
Sequence 768 from Patent WO0123604.
AX110035.1:556-570
CGTGATGAGGAAGGTCAAGATGTGTTGCTC556TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCTGAAGTG
Sequence 770 from Patent WO0123604.
AX110037.1:319-333
CGTGACGAGGAAGGTCAGGATGTGCTGCTC319TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 773 from Patent WO0123604.
AX110040.1:417-431
ATGCTAACAACAATGACAACAGTGCTTCTC417TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
Sequence 889 from Patent WO0123604.
AX110156.1:332-346
CGTGACGAGGAGGGTCAGGACGTGCTGCTC332TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 890 from Patent WO0123604.
AX110157.1:305-319
CGTGACGAGGAAGGTCAGGACGTGCTTCTC305TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
Sequence 892 from Patent WO0123604.
AX110159.1:320-334
CGTGACGAGGAAGGTCAGGACGTGCTTCTC320TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
Sequence 896 from Patent WO0123604.
AX110163.1:324-338
CGTGACGAGGAGGGTCAGGACGTGCTGCTC324TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 1638 from Patent WO0123604.
AX110905.1:344-358
CGTGACGAGGAGGGTCAGGACGTGCTGCTC344TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 1653 from Patent WO0123604.
AX110920.1:384-398
CGTGACGAGGAGGGCCAGGATGTGCTTCTC384TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 1654 from Patent WO0123604.
AX110921.1:403-417
AGAGACGAGGAGGGTCAGGACGTGCTGCTT403TTCATTGACAACATTTTCCGATTCACTCAGGCCGGTTCCGAGGTG
Sequence 1846 from Patent WO0123604.
AX111113.1:675-689
CGTGATGAGGAAGGHCAAGATGTGTTGCTC675TTCATTGACAACATTTTCCGTTTCACCCAAGCTGGTTCTGAAGTG
Sequence 1847 from Patent WO0123604.
AX111114.1:319-333
CGTGACGAGGAGGGTCAAGATGTGCTTCTC319TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
Sequence 2191 from Patent WO0123604.
AX111458.1:302-316
CGTGACGAGGAGGGTCAGGACGTGCTGCTC302TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Sequence 258 from Patent WO0164876.
AX269627.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Sequence 258 from Patent WO0164877.
AX271158.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Sequence 1 from Patent WO0164877.
AX282122.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Sequence 1 from Patent WO0164876.
AX282714.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 2002519000-A/2351: Novel human genes and gene expression products ii.
BD214209.1:175-189
ATTGTAATAGCCAGAAATTGGAAACATATA175TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
JP 2002519000-A/3881: Novel human genes and gene expression products ii.
BD215739.1:128-142
ATTGTAATAGCCAGAAATTGGAAACATATA128TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Sequence 60447 from Patent WO0160860.
CQ528580.1:96-110
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC96TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
Sequence 60615 from Patent WO0160860.
CQ528748.1:96-110
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC96TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
Sequence 11087 from Patent WO0171042.
CQ583329.1:988-1002
CGCGACGTGGACGGGCAGGATGTGCTGCTC988TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
JP 2004513607-A/1: HUMAN SCHIZOPHRENIA GENE.
DD021122.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 2004513607-A/220: HUMAN SCHIZOPHRENIA GENE.
DD021341.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 2004527203-A/1: HUMAN SCHIZOPHRENIA GENE.
DD062477.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 2004527203-A/220: HUMAN SCHIZOPHRENIA GENE.
DD062696.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 2006212019-A/5: A method to produce ubiquinone-10 in plant.
DD402964.1:990-1004
CGTGATGCCGAAGGTCAAGATGTGCTTTTG990TTCATTGACAACATTTTTCGTTTCACTCAGGCGAACTCTGAGGTG
KR 1020027011282-A/1: HUMAN SCHIZOPHRENIA GENE.
DI046388.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
KR 1020027011283-A/1: HUMAN SCHIZOPHRENIA GENE.
DI049443.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
KR 1020027011282-A/258: HUMAN SCHIZOPHRENIA GENE.
DI051164.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
KR 1020027011283-A/258: HUMAN SCHIZOPHRENIA GENE.
DI082651.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 1993137581-A/1: cDNA encoding Oryza mitochondria ATPase beta subunit.
E05034.1:990-1004
CGTGATGCCGAAGGTCAAGATGTGCTTTTG990TTCATTGACAACATTTTTCGTTTCACTCAGGCGAACTCTGAGGTG
Sequence 3819 from patent US 7186513.
EA081559.1:224-238
CGTGACGAGGAGGGTCAGGACGTGCTGCTC224TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 1766 from patent US 7309815.
EA366915.1:1048-1062
AGAGATGCTGAGGGGCAGGATGTGCTTCTC1048TTCATTGACAACATTTTCAGATTTACCCAGGCTAACTCAGAGGTG
Sequence 27655 from patent US 7314974.
EA378832.1:1133-1147
CCGTTGCTAACGCAGTCTGTAGTGTTGCTC1133TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 36200 from patent US 7314974.
EA387376.1:892-906
CGTGACGAGGAGGGTCAGGACGTGCTGCTC892TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Uncultured Flavobacteriia bacterium.
FO117603.1:16462-16476
AGTTAATGGCATTGGTTACTGGGTTAATAT16462TTCATTGACAACATTCTCACAAATACCTGATAATGAGAATATAAA
Uncultured bacterium clone VISS18_097 genomic sequence.
KX158548.1:16462-16476
AGTTAATGGCATTGGTTACTGGGTTAATAT16462TTCATTGACAACATTCTCACAAATACCTGATAATGAGAATATAAA
Homavirus sp. clone Homavirus_44 genomic sequence.
MK072375.1:2043-2057
ACGATTAGGTGCGGCATTAAGAAAAAACAG2043TTCATTGACAACATTGGATTTGGAAGATAATTACTTCAATAGTGA
Siphoviridae sp. isolate 87, complete genome.
MN855792.1:19506-19520
CTTTCCGGGCAAGACTTTACTAAGCTTGAC19506TTCATTGACAACATTGAAGCCGCTTTTGTTGATTCCGATTCGGAT
Eukaryotic synthetic construct chromosome 1.
CP034487.1:83452476-83452490
CTAATTAATGAATAGTAAGTATATTTTCTC83452476TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
Eukaryotic synthetic construct chromosome 11.
CP034489.1:24434030-24434044
TTGAGTTTCCTGGAACATAGATATGTCTTG24434030TTCATTGACAACATTCTAGCATTGAGGACAGTGAATAGAGAAAAG
Eukaryotic synthetic construct chromosome 13.
CP034491.1:65745547-65745561
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA65745547TTCATTGACAACATTTCCTGAGGTAACTCACACTGAGGTGACAAC
Eukaryotic synthetic construct chromosome 18.
CP034496.1:27141689-27141703
ATATTTATATATGTATATATTTCATATTAT27141689TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
Eukaryotic synthetic construct chromosome 19.
CP034497.1:41507266-41507280
AAGCCACCACACCCGGCCTATCTTAGCTTT41507266TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Eukaryotic synthetic construct chromosome 2.
CP034498.1:161213115-161213129
ATTGCAGCAAAGAAGCACATTTATATTCTA161213115TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACAT
Eukaryotic synthetic construct chromosome 3.
CP034502.1:15229790-15229804
ATTGTAATAGCCAGAAATTGGAAACATATA15229790TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Eukaryotic synthetic construct chromosome 3.
CP034502.1:84559845-84559859
TTGGTTTTGTATATATTAAATAGTTGAAAC84559845TTCATTGACAACATTAAGTTTGTTTTCTAGGCTCTATTGGGATAA
Eukaryotic synthetic construct chromosome 3.
CP034502.1:210776939-210776953
ATTGTAATAGCCAGAAATTGGAAACATATA210776939TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Eukaryotic synthetic construct chromosome 4.
CP034503.1:16124651-16124665
AACGAAAGGCGTTTGAGGAAAGCCTGATAA16124651TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
Eukaryotic synthetic construct chromosome 4.
CP034503.1:63021140-63021154
TCTTCAAATATTTTACAGAGTTCAACTCTT63021140TTCATTGACAACATTATGACATTATGCTGATTGGATCCAGTGAGT
Eukaryotic synthetic construct chromosome 4.
CP034503.1:149823218-149823232
CAGAATATATTATCGCTTTAAACACAGATT149823218TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
Eukaryotic synthetic construct chromosome 4.
CP034503.1:166712150-166712164
AAAAACGTCTGATTTTGTGTAACACTCCTT166712150TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
Eukaryotic synthetic construct chromosome 4.
CP034503.1:204889498-204889512
AACGAAAGGCGTTTGAGGAAAGCCTGATAA204889498TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
Eukaryotic synthetic construct chromosome 6.
CP034505.1:62648216-62648230
CTATTTCAATCAACCATCTTGTAATCATAC62648216TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
Eukaryotic synthetic construct chromosome 7.
CP034506.1:3553673-3553687
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC3553673TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
Eukaryotic synthetic construct chromosome 7.
CP034506.1:160703102-160703116
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC160703102TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
Eukaryotic synthetic construct chromosome 8.
CP034507.1:31346145-31346159
GTATTTTTAAATTCATCGATATTTCCACTT31346145TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Eukaryotic synthetic construct chromosome 1.
CP034512.1:83452476-83452490
CTAATTAATGAATAGTAAGTATATTTTCTC83452476TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
Eukaryotic synthetic construct chromosome 11.
CP034514.1:24434030-24434044
TTGAGTTTCCTGGAACATAGATATGTCTTG24434030TTCATTGACAACATTCTAGCATTGAGGACAGTGAATAGAGAAAAG
Eukaryotic synthetic construct chromosome 13.
CP034516.1:65745547-65745561
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA65745547TTCATTGACAACATTTCCTGAGGTAACTCACACTGAGGTGACAAC
Eukaryotic synthetic construct chromosome 18.
CP034521.1:27141689-27141703
ATATTTATATATGTATATATTTCATATTAT27141689TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
Eukaryotic synthetic construct chromosome 19.
CP034522.1:41507266-41507280
AAGCCACCACACCCGGCCTATCTTAGCTTT41507266TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Eukaryotic synthetic construct chromosome 2.
CP034523.1:161213115-161213129
ATTGCAGCAAAGAAGCACATTTATATTCTA161213115TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
Eukaryotic synthetic construct chromosome 3.
CP034527.1:15229790-15229804
ATTGTAATAGCCAGAAATTGGAAACATATA15229790TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Eukaryotic synthetic construct chromosome 3.
CP034527.1:84559845-84559859
TTGGTTTTGTATATATTAAATAGTTGAAAC84559845TTCATTGACAACATTAAGTTTGTTTTCTAGGCTCTATTGGGATAA
Eukaryotic synthetic construct chromosome 3.
CP034527.1:210776939-210776953
ATTGTAATAGCCAGAAATTGGAAACATATA210776939TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Eukaryotic synthetic construct chromosome 4.
CP034528.1:16124651-16124665
AACGAAAGGCGTTTGAGGAAAGCCTGATAA16124651TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
Eukaryotic synthetic construct chromosome 4.
CP034528.1:63021140-63021154
TCTTCAAATATTTTACAGAGTTCAACTCTT63021140TTCATTGACAACATTATGACATTATGCTGATTGGATCCAGTGAGT
Eukaryotic synthetic construct chromosome 4.
CP034528.1:149823218-149823232
CAGAATATATTATCGCTTTAAACACAGATT149823218TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
Eukaryotic synthetic construct chromosome 4.
CP034528.1:166712150-166712164
AAAAACGTCTGATTTTGTGTAACACTCCTT166712150TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
Eukaryotic synthetic construct chromosome 4.
CP034528.1:204889498-204889512
AACGAAAGGCGTTTGAGGAAAGCCTGATAA204889498TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
Eukaryotic synthetic construct chromosome 6.
CP034530.1:62648216-62648230
CTATTTCAATCAACCATCTTGTAATCATAC62648216TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
Eukaryotic synthetic construct chromosome 7.
CP034531.1:3553673-3553687
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC3553673TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
Eukaryotic synthetic construct chromosome 7.
CP034531.1:160703102-160703116
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC160703102TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
Eukaryotic synthetic construct chromosome 8.
CP034532.1:31346145-31346159
GTATTTTTAAATTCATCGATATTTCCACTT31346145TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Synthetic construct clone BS13637 ms(3)72Dt-PA (ms(3)72Dt) gene, complete cds.
KX804458.1:1058-1072
CGCGACGTGGACGGGCAGGATGTGCTGCTC1058TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Synthetic construct bacterial decoy, complete sequence.
MT169739.1:62491296-62491310
CATCTTGGCGTTTGTAAGTATCTTTGTTCT62491296TTCATTGACAACATTGACGACAGTCTTTGGTGCTGAAGTAACAAA
25940 Lambda-PRL2 Arabidopsis thaliana cDNA clone 305F5T7, mRNA sequence.
AA394357.1:46-60
CGTGATGCTGAAGGCCAAGACGTTTTGCTT46TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
17 Loblolly pine N Pinus taeda cDNA clone 2N12H, mRNA sequence.
AA556162.1:129-143
CGAGATGCCGAAGGCCAGGATGTGTTGCTC129TTCATTGACAACATTTTCCGTTTTACACAAGCAAACTCTGAAGTG
MCCE3476.M1F Schistosoma mansoni, cercariae Schistosoma mansoni cDNA clone SMC3476 3' end, mRNA sequence.
AA999551.1:228-242
TCACGAAACTTAAACTACCTACTTGTCACA228TTCATTGACAACATTCAGCTGAATGGTGACGGATTCCGGTTTCCC
coau0002F12 Cotton Boll Abscission Zone cDNA Library Gossypium hirsutum cDNA clone coau0002F12 5', mRNA sequence.
AI054854.1:197-211
CGTGATGCAGAAGGGCAGGATGTGCTTCTC197TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTTCTGAAGT
y8h10a1.r1 Aspergillus nidulans 24hr asexual developmental and vegetative cDNA lambda zap library Aspergillus nidulans cDNA clone y8h10a1 5', mRNA sequence.
AI213281.1:56-70
CGTGACGAGGAGGGTCAGGACGTGCTGCTC56TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
NCSC1F11T3 Subtracted Conidial Neurospora crassa cDNA clone SC1F11 5' similar to ATP synthase, beta chain, mitochondrial, N. crassa, mRNA sequence.
AI392300.1:22-36
GAATTCGGCACGACGTTGCTC22TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAAGTG
NCSC3G5T3 Subtracted Conidial Neurospora crassa cDNA clone SC3G5 5' similar to ATP synthase, beta chain, mitochondrial, N. crassa, mRNA sequence.
AI392501.1:409-423
CGTGATGAGGAGGGTCAGGATGTGTTGCTC409TTCATTGACAACATTTTCCGTTTCACCCACGCCGGTTCTGAGGTG
BNLGHi5305 Six-day Cotton fiber Gossypium hirsutum cDNA 5' similar to ATP SYNTHASE BETA CHAIN, MITOCHONDRIAL, mRNA sequence.
AI726218.1:397-411
CGTGATGCAAAAGGGCAGGATGTGCTTCTC397TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG
BNLGHi5214 Six-day Cotton fiber Gossypium hirsutum cDNA 5' similar to ATP SYNTHASE BETA CHAIN, MITOCHONDRIAL, mRNA sequence.
AI729802.1:363-377
CGTGATGCTGAAGGGCAGGATGTGCTTCTC363TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG
Trichoderma atroviride EST, clone L51TP1P005R00464.
AJ912423.1:146-160
TTCGGCCATTACGGCCGGGATGTCCTGCTC146TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCTGAGGTG
Bos indicus 3' EST, clone C0006008g11.
AM037005.1:522-536
CGAAGGGGACAGGGATGTGGGGGGAGCCTC522TTCATTGACAACATTCCTTACTCCA
Brassica oleracea var. alboglabra EST, clone AAFC_WHRI_BoE01a005M17_SP6.
AM057840.1:398-412
CGTGATGCCGAAGGCCAAGATGTGTTGCTT398TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
Lutzomyia longipalpis EST clone SFM-02d05, sequence read SFM-02d05.q1ka.
AM094584.1:804-818
CGTGATCAGGAAGGACAGGATGTATTGCTT804TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGGTTCTGAGGT
Fredericella sultana EST, clone P5D10.
AM110379.1:332-346
TATTCAATTCACTCAAACACAAATACTTCC332TTCATTGACAACATTAAGTTTTCATTTAATCAGAATCGTAAAAAT
Oryzias latipes EST, clone McF0005J16-MGRbd1.
AM138095.1:263-277
TGTAACCCTAACCTGCAGGTCTTCAATGTA263TTCATTGACAACATTGATGAGAGGCTCCCCAGAATCGCTCTGTTC
Picea abies EST, clone K0000400040B11F1.
AM173967.1:145-159
CGAGATGCCGAAGGCCAGGATGTGTTGCTC145TTCATTGACAACATTTTCCGTTTTACACAGGCAAACTCTGAAGTG
Brassica oleracea var. alboglabra EST, clone AAFC_WHRI_BoE02a017B04_T7.
AM391442.1:494-508
CGTGATGCTGAAGGCCAAGATGTGTTGCTT494TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
Cucumis melo subsp. melo EST, clone PS_20-B05-M13R.
AM716755.2:180-194
CGTGATGCTGAAGGACTGGATGTGCTTCTC180TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
Cucumis melo subsp. melo EST, clone CI_22-C08-M13R.
AM734939.2:179-193
CGTGATGCTGAAGGACAGGATGTGCTTCTC179TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
Venerupis (Ruditapes) philippinarum EST, 5' end sequence, clone mge013P0004M17.
AM876147.1:306-320
CGTGACCAGGAAGGCCAGGATGTGTTGCTC306TTCATTGACAACATTTTCAGATTCACACAAGCTGGTTCAGAGGTA
Venerupis (Ruditapes) philippinarum EST, 5' end sequence, clone mge013P0006K07.
AM876814.1:270-284
CGTGACCAGGAAGGCCAGGATGTGTTGCTC270TTCATTGACAACATTTTCAGATTCACACAAGCTGGTTCAGAGGTA
Oryza sativa Japonica Group cDNA, partial sequence (C50587_2A).
AU062818.1:208-222
CCGTGATGCCGAAGACAAGATGTGCTTTTN208TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Oryza sativa Japonica Group cDNA, partial sequence (C50480_7A).
AU093245.1:209-223
CGTGATGCCGAAGGACAAGATGTGCTTTTG209TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Oryza sativa Japonica Group cDNA, partial sequence (E1968_1A).
AU197246.1:257-271
CGTGATGCCGAAGGACAAGATGTGCTTTTG257TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Caenorhabditis elegans cDNA clone:yk756h08 : 5' end, single read.
AU198838.1:392-406
CGTGACCAGGAAGGACAAGATGTGCTTCTT392TTCATTGACAACATTTTCCGTTTCACCCAGGCTGGATCTGAAGTG
Caenorhabditis elegans cDNA clone:yk898h12 : 5' end, single read.
AU208829.1:505-519
CGTGACCAGGAAGGACAAGATGTGCTTCTT505TTCATTGACAACATTTTCCGTTTCACCCAGGCTGGATCTGAAGTG
Oryza sativa Japonica Group Koshihikari cDNA, clone:KP3-0874.
AU225844.1:500-514
CGTGATGCCGAAGGACAAGATGTGCTTTTG500TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Bombyx mori cDNA clone:e96h0862.
AV401548.1:544-558
CGTGATCAAGAAGGACAGGATGTACTGCTC544TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
Bombyx mori cDNA clone:prgv0416.
AV404766.1:597-611
GTGATCAAGAAGGACAGGATGTACTGCTTC597TTCATTGACAACATTTTTCCGTTTCACTCAGGCTGGATTCAGAAG
Arabidopsis thaliana cDNA clone:APZ18f08R, 5' end.
AV526666.1:15-29
AAGATGTCTTGCTT15TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:RZ107b10R, 5' end.
AV550021.1:350-364
CGTGATGCTGAAGGCCAAGACGTTTTGCTT350TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:RZ118e03R, 5' end.
AV550868.1:507-521
CGTGATGCTGAAGGCCAAGATGTCTTGCTT507TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:RZ129a08R, 5' end.
AV551608.1:470-484
CGTGATGCTGAAGGCCAAGACGTTTTGCTT470TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:SQ053a07F, 3' end.
AV556814.1:51-65
CGTGATGCTGAAGGCCAAGATGTCTTGCTT51TTCATTGACAACATTTTCCGTTTCACTAAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:SQ066b05F, 3' end.
AV557336.1:113-127
CGTGATGCTGAAGGCCAAGATGTCTTGCTT113TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:SQ182h07F, 3' end.
AV563191.1:51-65
CGTGATGCTGAAGGCCAAGATGTCTTGCTT51TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
ST34F10 Pine TriplEx shoot tip library Pinus taeda cDNA clone ST34F10, mRNA sequence.
AW064699.1:230-244
AAGATGCCGAAGGGCAAGGATGTGTTGCTC230TTCATTGACAACATTTTCCGTTTTACACAAAGCAAAACTCCTGAA
bl18b05.w1 Blackshear/Soares normalized Xenopus egg library Xenopus laevis cDNA clone PBX0018B05 5', mRNA sequence.
AW634146.1:55-69
AGAGATCAAGAGGGACAAGATGTGTTGCTT55TTCATTGACAACATTTTCAGGTTCACCCAGGCTGGTTCAGAGGTG
Bombyx mori cDNA, clone:E_ET_psgV_10H03_F_0, 5' end sequence.
BB988320.1:139-153
CGTGATCAAGAAGGACAGGATGTACTGCTC139TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
IpHdk00275 Head kidney cDNA library Ictalurus punctatus cDNA 5' similar to ATP synthase beta-subunit, mRNA sequence.
BE469082.1:113-127
CGTGATCAGGAGGGACAGGACGTGCTGCTT113TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
M16B5STM Arabidopsis developing seed Arabidopsis thaliana cDNA clone M16B5 5', mRNA sequence.
BE520998.1:214-228
CGTGATGCTGAAGGCCAAGATGTCTTGCTT214TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
M32B11STM Arabidopsis developing seed Arabidopsis thaliana cDNA clone M32B11 5', mRNA sequence.
BE523083.1:201-215
CGTGATGCTGAAGGCCAAGATGTCTTGCTT201TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
an_3252 Aspergillus niger, pYES2 (XhoI-EcoRI) Aspergillus niger cDNA clone 3252 5', mRNA sequence.
BE758985.1:2-16
C2TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
NXCI_133_B11_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda cDNA clone NXCI_133_B11 5' similar to Arabidopsis thaliana sequence At5g08680 H+-transporting ATP synthase beta chain (mitochondri
BF186138.1:85-99
CGAGATGCCGAAGGCCAGGATGTGTTGCTC85TTCATTGACAACATTTTCCGTTTTACACAAGCAAACTCTGAAGTG
602137981F1 NIH_MGC_83 Homo sapiens cDNA clone IMAGE:4274229 5', mRNA sequence.
BF674822.1:338-352
GATCCCCTCGAAGACTACTCTGTTACCAGG338TTCATTGACAACATTTCAAAAGCTTACAAAAAAACAGAACAGACA
NXSI_096_A10_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA clone NXSI_096_A10 5' similar to Arabidopsis thaliana sequence At5g08680 H+-transporting ATP synthase beta chain (mitochondrial) -li
BG039201.1:23-37
CGAAGGCCAGGATGTGTTGCTC23TTCATTGACAACATTTTCCGTTTTACACAAGCAAACTCTGAAGTG
EST471016 tomato shoot/meristem Solanum lycopersicum cDNA clone cTOF8M10 5' sequence, mRNA sequence.
BG125370.1:271-285
AACAAAATAATTGACTCTAAGCTAAAATAA271TTCATTGACAACATTTTCTTGCCATGTCCTTGTGTAAATGATCTC
S10-1-D6 Stage 10+ Gastrula Library Xenopus laevis cDNA 5' similar to ATP synthase BETA CHAIN (partial) mitochondrial, mRNA sequence.
BG409503.1:582-596
AGAGATCAAGAGGGACAAGATGTGTTGCTT582TTCATTGACAACATTTTCAGGTTTACCCAGGCTGGATCAGAGGTA
GA__Ea0011A22f Gossypium arboreum 7-10 dpa fiber library Gossypium arboreum cDNA clone GA__Ea0011A22f, mRNA sequence.
BG440940.1:166-180
CGTGATGCTGAAGGGCAGGATGTGCTTCTC166TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG
GA__Ea0014J21f Gossypium arboreum 7-10 dpa fiber library Gossypium arboreum cDNA clone GA__Ea0014J21f, mRNA sequence.
BG441779.1:174-188
CGTGATGCTGAAGGGCAGGATGTGCTTCTC174TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG
TSA: Armigeres subalbatus ASAP ID ACN-0188192 ATP synthase mRNA sequence.
EU207929.1:213-227
CGCGATCAAGAAGGACAGGATGTGCTGCTC213TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGGGGTA
TSA: Culex tarsalis Ctar-411 ATP synthase beta subunit mRNA, partial cds, mRNA sequence.
EZ000525.1:640-654
CGTGACCAGGAGGGACAGGACGTGCTGCTG640TTCATTGACAACATTTTCCGCTTCACCCAGGCCGGTTCGGAGGTG
TSA: Artemisia annua strain Artemis Contig6533.Aml mRNA sequence.
EZ192976.1:680-694
AGAGATGCCGAAGGACAAGATGTGCTTCTC680TTCATTGACAACATTTTCCGTTTTACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Artemis Contig26716.Aylt mRNA sequence.
EZ229705.1:1073-1087
AGAGATGCTGAAGGACAAGATGTGCTTCTC1073TTCATTGACAACATTTTCCGTTTCACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Madagascar Contig13713.Blm mRNA sequence.
EZ307828.1:693-707
AGAGATGCCGAAGGACAAGATGTGCTTCTC693TTCATTGACAACATTTTCCGTTTCACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Madagascar Contig7513.Blt mRNA sequence.
EZ320967.1:698-712
AGAGATGCCGAAGGACAAGATGTGCTTCTC698TTCATTGACAACATTTTCCGTTTCACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Uganda Contig4834.Uht mRNA sequence.
EZ357673.1:784-798
AGAGATGCCGAAGGACAAGATGTGCTTCTC784TTCATTGACAACATTTTCCGTTTCACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Uganda Contig14093.Ulm mRNA sequence.
EZ380642.1:94-108
AGAGATGCTGAAGGACAAGACGTGCTTCTC94TTCATTGACAACATTTTCCGTTTTACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Uganda Contig15540, mRNA sequence.
EZ399045.1:237-251
AGAGATGCTGAAGGACAAGATGTGCTTCTC237TTCATTGACAACATTTTCCGTTTCACCCAGGCCAACTCTGAGGTG
TSA: Artemisia annua strain Uganda Contig21980, mRNA sequence.
EZ405485.1:772-786
CTAGTCTACGGTCAAATGAACGTGCTTCTC772TTCATTGACAACATTTTCCGTTTCACCCAGGCTAACTCTGAGGTG
TSA: Dermacentor variabilis contig07166.Dva, mRNA sequence.
EZ524416.1:36-50
CGTGACCACGAAGGACAGGACGTGCTGCTC36TTCATTGACAACATTTTCAGGTTCACCCAGGCTGGCTCTGAGGTG
TSA: Dermacentor variabilis contig07453.Dvc, mRNA sequence.
EZ540086.1:101-115
CGTGACCACGAAGGACAGGACGTGCTGCTC101TTCATTGACAACATTTTCAGGTTCACCCAGGCTGGCTCTGAGGTG
TSA: Sarcophaga crassipalpis HAHN.FLY.984.C1 mRNA sequence.
EZ598637.1:183-197
TATGTGGGGAGCCAACAGTGAGGCCAAACC183TTCATTGACAACATTACATGAGAAAGAATTTGCTGAACTCGTGAC
TSA: Sarcophaga crassipalpis HAHN.FLY.10747.C2 mRNA sequence.
EZ610914.1:976-990
CGTGATCAAGAAGGCCAAGATGTATTGCTT976TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTA
TSA: Soil metagenome mRNA, contig: MTC00862.
FX000862.1:272-286
CGTGACGAGGAAGGCCAGGATGTGTTGCTC272TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCTGAGGTG
TSA: Soil metagenome mRNA, contig: MTC15963.
FX015963.1:65-79
CGTGATGCTGAGGGTCAGGATGTGCTTCTC65TTCATTGACAACATTTTCCGATTCACTCAGGCCGGTTCCGAGGTG
TSA: Schima mertensiana mRNA, contig: Sm_rep_c3267.
FX148844.1:825-839
CCATTCAAGAGATGACCTTTGATGATTCCA825TTCATTGACAACATTTTCTTCTCTTCTTCCTCCTCTTTCTCCTCC
TSA: Raphanus sativus var. sativus RNA, contig: WG3_1168.
FX674174.1:259-273
CGTGATGCCGAAGGCCAAGATGTGTTGCTT259TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Raphanus sativus var. sativus RNA, contig: WG3_14200.
FX680946.1:240-254
CGTGATGCCGAAGGCCAGGATGTGTTGCTT240TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Brassica rapa subsp. pekinensis RNA, contig: CF3_757.
FX706851.1:46-60
CGTGATGCTGAAGGCCAAGATGTGTTGCTT46TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Brassica rapa subsp. pekinensis RNA, contig: CF3_9230.
FX712463.1:46-60
CGTGATGCTGAAGGCCAAGATGTGTTGCTT46TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Brassica rapa x Raphanus sativus RNA, contig: BB3_6874.
FX749473.1:223-237
CGTGATGCCGAGGGCCAAGATGTGTTGCTT223TTCATTGACAACATTTTCCGATTCACTCAGGCCAACTCTGAAGTG
TSA: Brassica rapa x Raphanus sativus RNA, contig: BB3_15752.
FX757844.1:223-237
CGTGATGCCGAAGGCCAAGATGTGTTGCTT223TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Brassica rapa x Raphanus sativus RNA, contig: BB3_27.
FX758849.1:13-27
GATGTGTTGCTT13TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Brassica rapa x Raphanus sativus RNA, contig: BB3_4247.
FX780715.1:187-201
CGTGATGCTGAAGGCCAAGATGTGTTGCTT187TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Lygodium japonicum RNA, contig: isotig02259_gene=isogroup00121.
FX947309.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02260_gene=isogroup00121.
FX947310.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02261_gene=isogroup00121.
FX947311.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02262_gene=isogroup00121.
FX947312.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02263_gene=isogroup00121.
FX947313.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02264_gene=isogroup00121.
FX947314.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02265_gene=isogroup00121.
FX947315.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02266_gene=isogroup00121.
FX947316.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Adineta ricciae, contig 30360.
HE701972.1:239-253
TATTTCACTTGACAATTGCGCTTCGTAGAT239TTCATTGACAACATTGTTACCTAATTCTGACATGACTAACAATGT
TSA: Sedum alfredii, clone Sa_Contig10237.
HE727342.1:232-246
AGGGACGCTGAAGGTCAAGATGTGCTTCTC232TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCGGAAGTG
TSA: Psychotria gabriellae, clone contig_3761.
HE824991.1:1102-1116
AGGGATGCAGAAGGGCAGGATGTGCTTCTC1102TTCATTGACAACATTTTCCGTTTTACTCAGGCAAACTCAGAAGTG
TSA: Placobranchus ocellatus 19016.Plocadult mRNA sequence.
HP182860.1:372-386
ATTCACAAAAAGCCACACAAAGTTCATAAT372TTCATTGACAACATTGTCAGTGTCACCGTATTCTCAACTAAAAAG
TSA: Placobranchus ocellatus 21076.Plocadult mRNA sequence.
HP184920.1:67-81
AGCAATTTTAGCTTACATAAAATTATTCGT67TTCATTGACAACATTTCATTAAACTTTTTGTTGTAAAACCGATGC
TSA: Ictalurus furcatus Contig10915.Icfu mRNA sequence.
HP440277.1:886-900
CGTGATCAGGAGGGACAGGACGTGCTGCTT886TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
TSA: Ictalurus furcatus Contig11840.Icfu mRNA sequence.
HP441176.1:342-356
CGTGATCAGGAGGGACAGGACGTGCTGCTT342TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
TSA: Apis mellifera isotig24228.Amelbrova mRNA sequence.
HP508150.1:1851-1865
CTTCGTTTTTATAAAAGATATTATTAAAAA1851TTCATTGACAACATTATTTTCATTTAAATATAATATATATTATGT
TSA: Ictalurus punctatus Contig18043.Icpu mRNA sequence.
HP596949.1:901-915
CGTGATCAGGAGGGACAGGACGTGCTGCTT901TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
TSA: Bemisia tabaci BT_B_ZJU_Singletons99742 mRNA sequence.
HP699394.1:345-359
AAATCGCAAATCTCTCACACATGCAAGGGC345TTCATTGACAACATTATTTTAGATGGCTGCTTATGCTCAAGGAAA
TSA: Ascaris suum ASCF_7137_1183 mRNA sequence.
JI175186.1:54-68
TTGAAATCACCGGTTGTTGTCATCATTGCA54TTCATTGACAACATTTTTGCACTTTTCTTAATGTGCTTTATATGT
TSA: Ananas comosus NODE_7039.Anco mRNA sequence.
JI407315.1:209-223
CGTGATGCCGAAGGGCAAGATGTGCTCCTT209TTCATTGACAACATTTTCCGCTTCACCCAAGCGAACTCAGAAGTG
TSA: Phalaenopsis aphrodite PATC029052 mRNA sequence.
JI683722.1:282-296
ATGTCAAATTCTAAATGCTCATCATCACCT282TTCATTGACAACATTTGTCATTCCTCTTAAGAACATTAACCCAAA
TSA: Phalaenopsis aphrodite PATC145937 mRNA sequence.
JI766274.1:135-149
AAGTGAGCAACTGCTTCAAACACATACATA135TTCATTGACAACATTAAATGCCAATCCGGCTGAGTAGCAAAACCT
TSA: Copidosoma floridanum isotig03701.Coflemb mRNA sequence.
JI834854.1:471-485
CGTGACCAGGAAGGACAAGACGTACTGCTG471TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAGGTA
TSA: Copidosoma floridanum isotig03702.Coflemb mRNA sequence.
JI834855.1:471-485
CGTGACCAGGAAGGACAAGACGTACTGCTG471TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAGGTA
TSA: Siraitia grosvenorii SIG_014389 mRNA sequence.
JL538567.1:168-182
CGTGATGCTGAAGGACAGGATGTGCTTCTC168TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
Mus musculus molossinus DNA, clone:MSMg01-304I21.T7, genomic survey sequence.
AG429799.1:1495-1509
CGTCCTATTGCATATTGTATATGTATATGA1495TTCATTGACAACATTTCTCAGTGTTATTCGATTAGTATATTATAN
Oryza sativa Indica Group genomic DNA, BAC end sequence, BAC clone:K0415E08_R.
AG897509.1:417-431
CGTGTGCCTCCTGGATGCACCAATCGGCTG417TTCATTGACAACATTTTGTTGAAGGACCTTGGGCACATCTTTTTG
Hemicentrotus pulcherrimus BAC clone: BUB1-14M13_R, 3'end.
AG990527.1:71-85
CGAGGNNNGNNTGAGTTTTGACTTGTGATT71TTCATTGACAACATTGATTCTACGACCTTAAACGTTGGGAATACA
T7 end of clone 021AC09 of library SmBAC1 from strain Puerto-Rican of Schistosoma mansoni.
AL619317.1:862-876
CACGAAACTTAAACCACCTACCTTGTCACA862TTCATTGACAACATTCAGCTGTATGGGAATCCM
HS_2026_B2_A05_T7C CIT Approved Human Genomic Sperm Library D Homo sapiens genomic clone Plate=2026 Col=10 Row=B, genomic survey sequence.
AQ767179.1:102-116
AGAGAATCTAAATGTGTTAATCTTATACAT102TTCATTGACAACATTCAGGTGCTATAAAAGAATTCATATACAATA
1M0497I09R Mouse 10kb plasmid UUGC1M library Mus musculus genomic clone UUGC1M0497I09 R, genomic survey sequence.
AZ637985.1:62-76
TGAACACATTCTCCCTGTTTGTGTCATCAC62TTCATTGACAACATTTAACTGGGCCTTCTGTGTGGATACCATGAT
021_E_17-21 SmBAC1 Schistosoma mansoni genomic clone 021E17 5', genomic survey sequence.
BH182368.1:862-876
CACGAAACTTAAACCACCTACCTTGTCACA862TTCATTGACAACATTCAGCTGTATGGGAATCCM
BOGQM31TR BOGQ Brassica oleracea genomic clone BOGQM31, genomic survey sequence.
BH566806.1:303-317
ATAACTACTTAAAAGTAAAAAATCATATCG303TTCATTGACAACATTTGGGTTGAAAAACTTATTTATAAATGCCAA
odg61a04.b1 B.oleracea002 Brassica oleracea genomic, genomic survey sequence.
BH982618.1:585-599
CGTACACGTCTTCTTGGTGTAGCTGATGAT585TTCATTGACAACATTCATCACGTCCATGCGCAAGTAGTCACCAAT
Danio rerio genomic clone DKEY-91L5, genomic survey sequence.
BX141546.1:345-359
GCGTCTGTTGCGGCGAAACTGTTGTCCTGC345TTCATTGACAACATTGTATGACCTTGGCTCATTTCTTTTTGAAAC
Danio rerio genomic clone DKEY-127P13, genomic survey sequence.
BX167931.1:562-576
CGGAGCGCAGGTTGAGATCTCCTTGCTGGT562TTCATTGACAACATTTCCGGCAGAAGCCTAGCTTTTCCCATGTGG
lkh10d05.b1 B.oleracea002 Brassica oleracea genomic, genomic survey sequence.
BZ087056.1:633-647
ATACTAATGGCTACTTGATTGCCCTCTTGC633TTCATTGACAACATTGGATTGGCCAATTTTTCCTTCACCATTTAA
CH230-520K10.TV CHORI-230 Segment 2 Rattus norvegicus genomic clone CH230-520K10, genomic survey sequence.
BZ258580.1:392-406
GAAGCTAATAGTGCAATCCGCATGGTCTCC392TTCATTGACAACATTAACAGCTGTAATAAAATCAAGATATTGGCA
BONCU32TR BO_1.6_2_KB_tot Brassica oleracea genomic clone BONCU32, genomic survey sequence.
BZ482258.1:591-605
CGTGATGCCGAAGGCCAAGATGTGTTGCTT591TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTCTGTTCTT
PUGDZ12TB ZM_0.6_1.0_KB Zea mays genomic clone ZMMBTa362B24, genomic survey sequence.
BZ826104.1:624-638
CCTAATACCAAATTCTGTGTTCCACATCAT624TTCATTGACAACATTCATCAACTCTTGAATGGAAGCCTTCTCTCT
PUGGR72TB ZM_0.6_1.0_KB Zea mays genomic clone ZMMBTa380K24, genomic survey sequence.
BZ977853.1:257-271
CCTAATAGCAAATTCCGTGTTCCACATCAT257TTCATTGACAACATTCATCAACTCTTGAATGGAAGCCTTCTCTCT
NDL.28K22.T7 Notre Dame Liverpool Aedes aegypti genomic clone NDL.28K22, genomic survey sequence.
CC129459.1:363-377
AAAAGTGCATCGAAAATACTGCGTTCAATT363TTCATTGACAACATTTGCAGAGATCTTTGAACTGCTTTGGCCGTT
CH261-83O17_Sp6.1 CH261 Gallus gallus genomic clone CH261-83O17, genomic survey sequence.
CC222036.1:416-430
TGCAGCAAATATTTTAAAGAAAACATGAAA416TTCATTGACAACATTTAATCAACAAATATTATTCAACCTTATTTG
PUHRC85TB ZM_0.6_1.0_KB Zea mays genomic clone ZMMBTa515O01, genomic survey sequence.
CC410912.1:348-362
CCTAATACCAAATTCTGTGTTCCACATCAT348TTCATTGACAACATTCATCAACTCTTGAATGGAAGCCTTCTCTCT
ZMMBBb0125N11.r ZMMBBb Zea mays subsp. mays genomic clone ZMMBBb0125N11 3', genomic survey sequence.
CC747628.1:502-516
AAGCCCGAATTAGACAAGTTTGTGGTGGTC502TTCATTGACAACATTTTGATCTATTCCAAGAATGAGGAGGAGCAT
NDL.56L11.SP6 Notre Dame Liverpool Aedes aegypti genomic clone NotreDame Liverpool-56L11, genomic survey sequence.
CC854470.1:326-340
AAAAGTGCATCGAAAATACTGCGTTCAATT326TTCATTGACAACATTTGCAGAGATCTTTGAACTGCTTTGGCCGTT
tigr-gss-dog-17000333871824 Dog Library Canis lupus familiaris genomic, genomic survey sequence.
CE292581.1:317-331
AATAAATTGAAAAGGACAAAGAGAATTTCA317TTCATTGACAACATTTTGTAAAATTATTTTATTTATTTATTTTAC
tigr-gss-dog-17000368574337 Dog Library Canis lupus familiaris genomic, genomic survey sequence.
CE691095.1:103-117
GTGTTATGTATACTTAAATACATAGCCTGT103TTCATTGACAACATTCTCTGGTGTTTCGGCCTCTCTTTTTTTCCT
tigr-gss-dog-17000315419960 Dog Library Canis lupus familiaris genomic, genomic survey sequence.
CE730781.1:71-85
ATTAAAGGAGATTAGTGTTAACATTTGGTT71TTCATTGACAACATTTAAATGAAAACATTCCTAGTCAGTGGGAAT
PUFZQ49TD ZM_0.6_1.0_KB Zea mays genomic clone ZMMBTa0769J01, genomic survey sequence.
CG150819.1:375-389
ATGGAAGAGTTAGATAAGTTTGTCGTAGTC375TTCATTGACAACATTCTCATCTACTCCAAGAGTCAACAGGAGCAT
OR_BBa0021J15.r OR_BBa Oryza sativa f. spontanea genomic clone OR_BBa0021J15 3', genomic survey sequence.
CL625609.1:198-212
CGTGTGCCTCCTGGATGCACCAATCGGCTG198TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
OR_BBa0068D17.f OR_BBa Oryza sativa f. spontanea genomic clone OR_BBa0068D17 5', genomic survey sequence.
CL734871.1:669-683
CGTGTGCCTCCTGGATGCACCAATCGGCTG669TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
OR_BBa0079G16.r OR_BBa Oryza sativa f. spontanea genomic clone OR_BBa0079G16 3', genomic survey sequence.
CL743153.1:668-682
CGTGTGCCTCCTGGATGCACCAATCGGCTG668TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
OR_CBa0013E05.r OR_CBa Oryza rufipogon genomic clone OR_CBa0013E05 3', genomic survey sequence.
CL801351.1:30-44
CATTGAACATTTATGTAGCGAACAAACAG30TTCATTGACAACATTTTGCAAAGTAGGTAGGGGTGCTCAATCATA
OR_CBa0024B18.f OR_CBa Oryza rufipogon genomic clone OR_CBa0024B18 5', genomic survey sequence.
CL809348.1:198-212
CGTGTGCCTCCTGGATGCACCAATCGGCTG198TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
OsIRUA003836 Oryza sativa Express Library Oryza sativa Indica Group genomic, genomic survey sequence.
CL950189.1:19-33
GCACGAGGGAACAAACAG19TTCATTGACAACATTTTGCAAAGTAGGTAGGGGTGCTCAAGCATA
OsIFCC022016 Oryza sativa Express Library Oryza sativa Indica Group genomic, genomic survey sequence.
CL971731.1:859-873
CGTGATGCCGAAGGACAAGATGTGCTTTTG859TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Arabidopsis thaliana T-DNA flanking sequence GK-719B07-025279.
CR357328.1:97-111
CGTGATGCTGAAGGCCAAGACGTTTTGCTT97TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCCTTGTTCCT
Arabidopsis thaliana T-DNA flanking sequence GK-719B07-025308.
CR357329.1:102-116
CGTGATGCTGAAGGCCAAGACGTTTTGCTT102TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCCTTGTTCCT
GR0AAA15DC03FM1 INRA BAC Bos taurus genomic clone INRAb_286C03, DNA sequence.
CR797373.1:711-725
CAGTGACTCCCCCTGACTCACTGCTTTAAA711TTCATTGACAACATTTTTTAAAAGGTAGAGAATTCTCATGAAGAG
GR0AAA71CF04RM1 INRA BAC Bos taurus genomic clone INRAb_918D12, DNA sequence.
CR837170.1:142-156
AGGGAATTCCAGAAAAACATCTACTTCCAT142TTCATTGACAACATTAAAGCCTTTGACTCTGTGGGTGAAAAATTC
104_783_11463335_148_36246_096 Sorghum methylation filtered library (LibID: 104) Sorghum bicolor genomic clone 11463335, genomic survey sequence.
CW299853.1:188-202
CACCTATGTACAGTTAATATTGCTTATCAG188TTCATTGACAACATTGCCCCACAGTGTATGGTGCTGAAATCCTGA
OA_ABa0135J24.r OA_ABa Oryza australiensis genomic clone OA_ABa0135J24 3', genomic survey sequence.
CW598640.1:293-307
ATGGAATACTTGGATAAGTTTGTTATTGTT293TTCATTGACAACATTCTCATCTACTCCAAGGATGAAAATGAGCAT
OA_ABa0186G07.r OA_ABa Oryza australiensis genomic clone OA_ABa0186G07 3', genomic survey sequence.
CW647308.1:286-300
ATGGAATACTTGGATAAGTTTGTTATTGTT286TTCATTGACAACATTCTCATCTACTCCAAGGATGAAAATGAGCAT
OA_BBa0031F11.f OA_BBa Oryza alta genomic clone OA_BBa0031F11 5', genomic survey sequence.
CZ136780.1:143-157
GATGGACAGTACATATATATTCCTGAAAAT143TTCATTGACAACATTGCATCCAATAGACATTTGCCAGGATTACGA
OA_BBa0034I01.r OA_BBa Oryza alta genomic clone OA_BBa0034I01 3', genomic survey sequence.
CZ138971.1:30-44
CATTGAACATTTATGTAGCGAACAAACAG30TTCATTGACAACATTTTGCAAAGTAGGTAGGGGTGCTCAATCATA
SRAA-aad22b01.g1 Strongyloides ratti whole genome shotgun library (SRAAGSS 004) Strongyloides ratti genomic, genomic survey sequence.
CZ538826.1:719-733
CGTGATCAAGAAGGACAAGATGTACTTCTT719TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAAGTA
OC__Ba0008N24.f OC__Ba Oryza coarctata genomic clone OC__Ba0008N24 5', genomic survey sequence.
CZ695580.1:14-28
ACAGCGAGATCAT14TTCATTGACAACATTTTTGGTGATATAAGAAAGTGGGTGACAACT
Oryzias latipes DNA, clone: ola1-116J03.R, genomic survey sequence.
DE250217.1:80-94
AATGTGGCAGATCTGAAGGATGTTGTGGAG80TTCATTGACAACATTTCTTGGAGCATTAAAAACATATACCAGTAA
Bombyx mori genomic DNA, BAC clone:BET_016_B23.
DE334697.1:603-617
CGGGTAGTGTTATTGTTAGAACATAGGACA603TTCATTGACAACATTATCAAG
Bombyx mori genomic DNA, Fosmid clone:GBMFno206_m06.b1.
DE564221.1:9-23
TAGAATTT9TTCATTGACAACATTACGGAGTGAACTAACACAATGATACATAGA
Macropus eugenii DNA, BAC clone: MEB1-071P08_F, 5'end.
DE894182.1:360-374
GGTCGTGGTGTGAGGGCTATAAAGAGTGAA360TTCATTGACAACATTCTAATGTTTTTCAGTGATAAAACAAAACAG
212482 Tomato MboI BAC Library Solanum lycopersicum genomic clone SL_MboI0117I20 5, genomic survey sequence.
DU950308.1:130-144
AAACCATTTCTGGATTCTTTTTTCATCATC130TTCATTGACAACATTTTGGTTTATTCGCAGAGTAAGGATGAGAAT
OR_ABa0216K08.f OR_ABa Oryza ridleyi genomic clone OR_ABa0216K08 5', genomic survey sequence.
DX305746.1:568-582
GACAACGTTCTAGACAAATTTGGCATGGTC568TTCATTGACAACATTCTTATCTATTCCACAACGAAGGAAGAACAT
CHORI103-8P10.TV CHORI103 Schistosoma mansoni genomic clone CHORI103-8P10, genomic survey sequence.
DX988859.1:613-627
AGAAGAAGAAATTGAAAGTGAAGAATTCAA613TTCATTGACAACATTTCAATCATGTAATACTGAAAAGAATTTAAA
Aspergillus oryzae cDNA, contig sequence: AoEST3165.
AB226303.1:974-988
CGTGACGAGGAAGGTCAGGATGTGCTGCTC974TTCATTGACAACATTTTCCGGTTTCACCCAGGCCGGTTCTGAGGT
Papilio xuthus mRNA for ATP synthase-beta, partial cds, sequence id: Px-0449, expressed in epidermis.
AK402800.1:932-946
CGTGACCAGGAGGGTCAGGATGTGCTGCTC932TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCTGAAGTG
Cryptomeria japonica mRNA, clone: CSFL002_L12, expressed in reproductive shoots.
AK414516.1:1224-1238
ATCCAGTCCACAGACCATGGCTATAAATGG1224TTCATTGACAACATTGCTAAACGTCCTTCAAGTTCTTGGTATTAT
Armigeres subalbatus ASAP ID: 41997 hydrogen transporting two sector ATPase mRNA sequence.
AY441405.1:185-199
CGCGATCAAGAAGGACAGGATGTGCTGCTC185TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGGGGTA
Aedes aegypti clone AET-272 F0F1-type ATP synthase beta subunit mRNA, complete cds.
DQ440233.1:838-852
CGTGATCAGGAAGGACAGGATGTGCTGCTC838TTCATTGACAACATTTTCCGTTTCACCCAAGCTGGTTCTGAGGTA
Bombyx mori H+ transporting ATP synthase beta subunit isoform 1 mRNA, complete cds.
DQ443321.1:992-1006
CGTGATCAAGAAGGACAGGATGTACTGCTC992TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
Bombyx mori H+ transporting ATP synthase beta subunit isoform 2 mRNA, complete cds.
DQ443322.1:975-989
CGTGATCAAGAAGGACAGGATGTACTGCTC975TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
Codosiga gracilis isolate ATCC 50964 pink-eyed dilution-like 1 mRNA, partial cds.
KU821761.1:1960-1974
GTCCTTTGGGTGTCCGCGATTGCATCTTCT1960TTCATTGACAACATTCCCTTCACCACTGCAATGATTCCTGTGATC
Stephanoeca diplocostata isolate ATCC PRA-392 pink-eyed dilution-like 2 mRNA, complete cds.
KU821781.1:2023-2037
GTGCTGTGGGTGTCGGCCATTGCGTCGTCC2023TTCATTGACAACATTCCGTTCACGGCTGCGATGATTCCCGTCATC
Caenorhabditis elegans clone Y55D5, *** SEQUENCING IN PROGRESS ***, 4 unordered pieces.
AC006880.1:52583-52597
ATTGTAGGAAATTTTGAGCTCTACAAGTAC52583TTCATTGACAACATTTTTGTAACTATTTCTCCCGCTGAGATACGT
Homo sapiens clone RP11-4D12, WORKING DRAFT SEQUENCE, 24 unordered pieces.
AC013582.4:135343-135357
CTAATTAATGAATAGTAAGTATATTTTCTC135343TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
Drosophila melanogaster, *** SEQUENCING IN PROGRESS ***.
AC020218.1:18270-18284
GTTAAATAATCTATCAAGCCTAAAGAGCCG18270TTCATTGACAACATTTAATAAGAGGATTAATGGGATTTTAAAGAG
Homo sapiens chromosome 20 clone RP11-186A1 map 20, LOW-PASS SEQUENCE SAMPLING.
AC023022.2:2553-2567
CATTGTGCTGAACACTNTACATTNCTTCAT2553TTCATTGACAACATTCACTGAACACCTGTANGTGCTGGGCTCTGT
Homo sapiens chromosome 1 clone RP11-474M18 map 1, WORKING DRAFT SEQUENCE, 12 unordered pieces.
AC023547.3:110306-110320
TTGGTTTTGTATATATTAAATAGTTGAAAC110306TTCATTGACAACATTAAGTTTGTTTTCTAGGCTCTATTGGGATAA
Homo sapiens chromosome 5 clone CTD-2185N19, WORKING DRAFT SEQUENCE, 35 unordered pieces.
AC025769.3:230404-230418
GAGCCACCATGCCTGGCCTATCTTAGCTTT230404TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Homo sapiens chromosome 4 clone RP11-191O7 map 4, WORKING DRAFT SEQUENCE, 21 unordered pieces.
AC067786.2:152243-152257
CTATTTCAATCAACCATCTTGTAATCATAC152243TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
Mus musculus strain C57BL6/J chromosome 5 clone RP23-348B11, WORKING DRAFT SEQUENCE, 15 unordered pieces.
AC074175.1:58655-58669
GTCAACATGTACTTTAAACTTTAGTAATGT58655TTCATTGACAACATTGATGCTTTTGGCTTGGGGGCATGGATGCTA
Homo sapiens chromosome 8 clone RP11-243G8 map 8, LOW-PASS SEQUENCE SAMPLING.
AC079058.1:21556-21570
AACGAAAGGCGTTTGAGGAAAGCCTGATAA21556TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
Rattus norvegicus clone CH230-9J19, WORKING DRAFT SEQUENCE.
AC095204.4:69755-69769
GCTCAAAAAGAAACTGCCTCAAAGACACAG69755TTCATTGACAACATTCTAGAAATTGGACAATGGATACATAAGAGA
Rattus norvegicus clone CH230-7C12, WORKING DRAFT SEQUENCE, 8 unordered pieces.
AC095419.12:72062-72076
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT72062TTCATTGACAACATTAAATATTTACTGAATCTTAAATCTTATCCT
Rattus norvegicus clone CH230-106K7, WORKING DRAFT SEQUENCE, 9 unordered pieces.
AC097862.6:46735-46749
TTTTCAAAATCTTTTGCCTGTATAGACTTT46735TTCATTGACAACATTAAACTGTATGACATGCAAAAAATAACAGGT
Homo sapiens chromosome 15 clone RP11-106G20 map 15, LOW-PASS SEQUENCE SAMPLING.
AC099834.2:51264-51278
ATATTTATATATGTATATATTTCATATTAT51264TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
Rattus norvegicus clone CH230-181M16, WORKING DRAFT SEQUENCE, 134 unordered pieces.
AC110677.4:628508-628522
ATTTTTCATGTGTTCGATGAAGCAGCAGTG628508TTCATTGACAACATTTGAAACCCACATACATGAATGAATAAGTAG
Mus musculus clone RP23-370G4, WORKING DRAFT SEQUENCE, 3 ordered pieces.
AC113179.3:72967-72981
ACTTTTCATGTGCTCAACGAAGTAACAGTG72967TTCATTGACAACATTTGAAAGCTACATCAATGAATAAATAGATAT
Rattus norvegicus clone CH230-16O6, WORKING DRAFT SEQUENCE, 2 unordered pieces.
AC114076.4:22686-22700
CACTAGGTTTGGAAAATTTTCTTCCACACC22686TTCATTGACAACATTTTTTTGTTTTTTTGTTTTTTTACTTGGTAT
Rattus norvegicus clone CH230-72E17, WORKING DRAFT SEQUENCE, 2 unordered pieces.
AC115329.3:106966-106980
AAACTGCGCTAAGCAAGACGGTATGGTATT106966TTCATTGACAACATTAAAGAAAATAGAGAGATAGACACTCGTGTG
Rattus norvegicus clone CH230-48L6, WORKING DRAFT SEQUENCE, 5 unordered pieces.
AC122612.4:139967-139981
TTTTTCAGATTATTTGATGAACAGATCTAT139967TTCATTGACAACATTAAAGTTTCAAATGTATAACTGTTGACAATG
Takifugu rubripes clone 263H22, WORKING DRAFT SEQUENCE, 5 ordered pieces.
AC123969.3:19353-19367
TGAATATTCAGGTTGTCAGAGTGAATAAGC19353TTCATTGACAACATTGTCTGTGTTTGGTCATTAATTACGGAGCGG
Rattus norvegicus clone CH230-unknown, WORKING DRAFT SEQUENCE, 9 unordered pieces.
AC137159.1:139084-139098
CACTAGGTTTGGAAAATTTTCTTCCACACC139084TTCATTGACAACATTTTTTTGTTTTTTTGTTTTTTTACTTGGTAT
Rattus norvegicus clone CH230-221L21, WORKING DRAFT SEQUENCE, 79 unordered pieces.
AC139384.3:14047-14061
TTTTTCAGATTATTTGATGAACAGATCTAT14047TTCATTGACAACATTAAAGTTTCAAATGTATAACTGTTGACAATG
Rattus norvegicus clone CH230-482C5, WORKING DRAFT SEQUENCE, 41 unordered pieces.
AC141547.1:144303-144317
ATTTTTCATGTGTTCGATGAAGCAGCAGTG144303TTCATTGACAACATTTGAAACCCACATACATGAATGAATAAGTAG
Rhinolophus ferrumequinum clone VMRC7-330G24, WORKING DRAFT SEQUENCE, 4 ordered pieces.
AC148392.2:40071-40085
GGATGGTTGCGATTTTCAATTGTTAACTGA40071TTCATTGACAACATTTGCAACTTGAGACCTCCAAGTTATTTCTGT
Bos taurus clone CH240-440P5, WORKING DRAFT SEQUENCE.
AC150633.6:91373-91387
ACTCCCCTAAATATAAGTCCCATTTCTCCT91373TTCATTGACAACATTTCAAACAGTATATGTCTTCTGTTTAAATTT
Bos taurus clone CH240-56N2, WORKING DRAFT SEQUENCE, 7 unordered pieces.
AC156915.3:204959-204973
CAGTGACTCCCCCTGACTCACTGCTTTAAA204959TTCATTGACAACATTTTTTAAAAGGTAGAGAATTCTCATGAAAAG
Bos taurus clone CH240-69O22, WORKING DRAFT SEQUENCE, 20 unordered pieces.
AC159483.3:150902-150916
ACTCCCCTAAATATAAGTCCCATTTCTCCT150902TTCATTGACAACATTTCAAACAGTATATGTCTTCTGTTTAAATTT
Bos taurus clone CH240-120C9, WORKING DRAFT SEQUENCE, 64 unordered pieces.
AC162563.4:318090-318104
ATATATGTTTTTAACCAGGGGCTCTACACA318090TTCATTGACAACATTGAAAAATCTCTTTCATTCCCTCCACACATC
Bos taurus clone CH240-165E18, WORKING DRAFT SEQUENCE, 13 unordered pieces.
AC165664.2:8552-8566
AGAAGTGTAATTACTGGGTCAGAATATGGA8552TTCATTGACAACATTTGGGCTTGTTAAAAATTCAGGTTATTGAGT
Strongylocentrotus purpuratus clone R3-13H8, WORKING DRAFT SEQUENCE, 31 unordered pieces.
AC168802.2:28295-28309
CATATCAAGGTTATTATTAAAAAGCCTCTT28295TTCATTGACAACATTTGAAAAGAAAAGAAAAATCCAAAAACCTCT
Bos taurus clone CH240-294L18, WORKING DRAFT SEQUENCE, 12 unordered pieces.
AC171473.4:41641-41655
AGGGAATTCCAGAAAAACATCTACTTCCAT41641TTCATTGACAACATTAAAGCCTTTGACTCTGTGGGTGAAAAATTC
Bos taurus clone CH240-120A2, WORKING DRAFT SEQUENCE, 8 unordered pieces.
AC171891.3:182387-182401
ATATATGTTTTTAACCAGGGGCTCTACACA182387TTCATTGACAACATTGAAAAATCTCTTTCATTCCCTCCACACATC
Strongylocentrotus purpuratus clone R3-1036D2, WORKING DRAFT SEQUENCE, 17 unordered pieces.
AC174509.2:102349-102363
ACTGATACACTGCTTGCTTCCCACTCTGAA102349TTCATTGACAACATTGGTGTCCAATGTACTACCACTAGTCTTGTA
Bos taurus clone CH240-309M12, WORKING DRAFT SEQUENCE, 5 unordered pieces.
AC175440.4:31224-31238
GCCAGTTGACCTTCAGAGCTTAGTTTGAAG31224TTCATTGACAACATTGGGAAGTGAGAATGCCACGGTGGGTCAGAG
Bos taurus clone CH240-397N16, WORKING DRAFT SEQUENCE, 10 unordered pieces.
AC177596.3:133194-133208
CAGTGACTCCCCCTGACTCACTGCTTTAAA133194TTCATTGACAACATTTTTTAAAAGGTAGAGAATTCTCATGAAAAG
Strongylocentrotus purpuratus clone R3-1007L24, WORKING DRAFT SEQUENCE, 20 unordered pieces.
AC179847.1:145715-145729
AGTTTTATTTTGACATAGTGTTCATTACGC145715TTCATTGACAACATTGACATGACTACAGCATCCTTAACACACGTG
Strongylocentrotus purpuratus clone R3-3090B11, WORKING DRAFT SEQUENCE, 34 unordered pieces.
AC184432.1:12689-12703
TTTGTAATTGTTCATATCTTATATCTCACT12689TTCATTGACAACATTCTATAAAACCTCAATGTTCAAACACAATAA
Zea mays cultivar B73 chromosome 4 clone CH201-177D4, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces.
AC184864.6:36338-36352
ATGGAATTTCTTGATAAGTTCATCGTGGTA36338TTCATTGACAACATTCTGGTTTATTCCAAGTATGATGGAGAACAT
Myotis lucifugus clone CH235-294A19, WORKING DRAFT SEQUENCE, 2 ordered pieces.
AC187663.2:115212-115226
CTTTTGATAAATCTCTAAAATGACATGTTA115212TTCATTGACAACATTACTTGAAGGAAAAATAAATAGGAGGACATA
Zea mays cultivar B73 chromosome 2 clone CH201-252L21, *** SEQUENCING IN PROGRESS ***, 17 unordered pieces.
AC187878.5:48943-48957
ATGCCAGAGCTGGACAAGTTTGTGGTGGTT48943TTCATTGACAACATTCTGGTTTATTCCAAAAATGAAGCTGAGCAT
Cavia porcellus clone CH234-504L11, WORKING DRAFT SEQUENCE, 5 ordered pieces.
AC189816.2:53655-53669
AAAAAGTCTTCATTGACAATGACAGGATAC53655TTCATTGACAACATTTAGCGAGGAGCAGGAGAACATTTTCCTAAG
Cavia porcellus clone CH234-165I22, WORKING DRAFT SEQUENCE.
AC189981.1:114959-114973
AAAAAGTCTTCATTGACAATGACAGGATAC114959TTCATTGACAACATTTAGCGAGGAGCAGGAGAACATTTTCCTAAG
Zea mays cultivar B73 chromosome 2 clone CH201-530G21, *** SEQUENCING IN PROGRESS ***, 19 unordered pieces.
AC194000.5:152602-152616
CTTCCTTTTAGAAACAGGTCTACGCGAACT152602TTCATTGACAACATTTGCATATATATATATATATATATATTCATT
Zea mays cultivar B73 chromosome 2 clone CH201-409P7, *** SEQUENCING IN PROGRESS ***, 15 unordered pieces.
AC195228.5:43633-43647
ATGGAATATCTTGATAAGTTTGTTGTGGTA43633TTCATTGACAACATTCTGATCTATTCCAAAAATGATGGAGAAAAT
Zea mays cultivar B73 chromosome 2 clone ZMMBBb-449J3, *** SEQUENCING IN PROGRESS ***, 17 unordered pieces.
AC197674.5:133563-133577
ATGCCAGAGCTGGACAAGTTTGTGGTGGTT133563TTCATTGACAACATTCTGGTTTATTCCAAAAATGAAGCTGAGCAT
Zea mays cultivar B73 chromosome 7 clone ZMMBBb-643N1, *** SEQUENCING IN PROGRESS ***, 9 unordered pieces.
AC198587.5:23056-23070
AGCATTTAAAGCATGATAAATTGTAGAAGG23056TTCATTGACAACATTTCTCCTAGGCATATGAACAACATTTCTACC
Zea mays cultivar B73 chromosome 7 clone CH201-176F9, *** SEQUENCING IN PROGRESS ***, 9 unordered pieces.
AC199224.5:98794-98808
CCTAATAGCAAATTCCGTGTTCCACATCAT98794TTCATTGACAACATTCATCAACTCTTGAATGGAAGCCTTCTCTCT
Zea mays cultivar B73 chromosome 10 clone CH201-408J13, *** SEQUENCING IN PROGRESS ***, 9 unordered pieces.
AC199619.4:102837-102851
ATGGACTATCTCGATAAGTTTGTGGTGGTA102837TTCATTGACAACATTCTGATTTATTCTCAAAGCGAAGAAGAGCAT
Zea mays cultivar B73 chromosome 9 clone CH201-441F3, *** SEQUENCING IN PROGRESS ***, 10 unordered pieces.
AC202061.4:87043-87057
ATGCCCGAGTTGGATAAATTTATGGTGGTC87043TTCATTGACAACATTTTGATCTATTCCAAAAAGTAAGAGGAGCAT
Zea mays cultivar B73 chromosome 5 clone ZMMBBb-537B13, *** SEQUENCING IN PROGRESS ***, 3 unordered pieces.
AC202913.5:49916-49930
ATGGAAGAGCTGGATAAGTTTGTCGTAGTC49916TTCATTGACAACATTCTTATCTACTCCAAGAACCGCGAAGACCAT
Zea mays cultivar B73 chromosome 10 clone CH201-52E5, *** SEQUENCING IN PROGRESS ***, 11 unordered pieces.
AC203309.4:96505-96519
AAGCCCGAATTAGACAAGTTTGTGGTGGTC96505TTCATTGACAACATTTTGATCTATTCCAAGAATGAGGAGGAGCAT
S217P60059FA7.T0 Noemie Pan troglodytes troglodytes STS genomic, sequence tagged site.
BV616112.1:618-632
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA618TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120/TTCATTGACAACATT
lang : en | db : ddbj120 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
1.510 | 1.504 | search_plus_done; http://172.18.8.71:27500/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
1.857 | 0.347 | search_minus_done; http://172.18.8.71:27500/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
1.857 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).