GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:35:27, GGGenome : DDBJ release 120.0, BCT division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Clostridium acetobutylicum ATCC 824, complete genome.
AE001437.1:2175576-2175590
GGTATTTTATCTTTATTTACAAAAACAGTC2175576TTCATTGACAACATTATTCTCGAAAGTTCTCCTCCTGATACAATT
Bacillus anthracis DNA, nearly complete genome, strain: Shikan-NIID.
AP014833.1:3943298-3943312
ATCGGAACGGTTCCAGCTAACAATACGGTG3943298TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Acinetobacter baumannii ATCC 17978, complete genome.
CP000521.1:1847708-1847722
ATGTTAAGCGATGCACCAGCATTGCAGTCA1847708TTCATTGACAACATTTTGCGCCATGGTCTTGACATCAAGCTTGAA
Chloroherpeton thalassium ATCC 35110, complete genome.
CP001100.1:1592376-1592390
CCTCATGAAGCGGGCAGCGGGATTGAGCAG1592376TTCATTGACAACATTCGCAAGCTCAATTTGCACAATTCCATTTTC
Bacillus cereus H3081.97 plasmid pH308197_258, complete sequence.
CP001166.1:40439-40453
ATAGGAACTGTTCCAGCTAACAACACGGTG40439TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
Bacillus anthracis str. CDC 684, complete genome.
CP001215.1:2712577-2712591
ATCGGAACGGTTCCAGCTAACAATACGGTG2712577TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Pasteurella multocida subsp. multocida str. 3480, complete genome.
CP001409.1:1644073-1644087
CAATTTTAATCTTGTCGCACCTGTCACCAA1644073TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence.
CP001904.1:293982-293996
ATAGGAACTGTTCCAGCTAACAACACGGTG293982TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
Arcobacter nitrofigilis DSM 7299 chromosome, complete genome.
CP001999.1:634479-634493
TTCAAGAACATTATCAAGAACTACTCTTAC634479TTCATTGACAACATTCTTTGTTGTTGCGACTTTATATTTCTTTGG
Thermoanaerobacter mathranii subsp. mathranii str. A3, complete genome.
CP002032.1:695794-695808
ATCCGATATTCTGTTTTTAGTGGATATGGG695794TTCATTGACAACATTTGGAGAAGAAATCGAAAAGGAGTTTGGCAT
Clostridium acetobutylicum EA 2018, complete genome.
CP002118.1:2174984-2174998
GGTATTTTATCTTTATTTACAAAAACAGTC2174984TTCATTGACAACATTATTCTCGAAAGTTCTCCTCCTGATACAATT
Caldicellulosiruptor obsidiansis OB47, complete genome.
CP002164.1:2291756-2291770
GCAGCAACAGAATTGCCTATTATAACATAC2291756TTCATTGACAACATTTCCCCCTTTTTAGACCTCTTTGATTTCAAG
Caldicellulosiruptor owensensis OL, complete genome.
CP002216.1:2207096-2207110
GCAGCAACAGAATTGCCTATTACAACATAC2207096TTCATTGACAACATTTCCCCCTTTTTTACACCTCTTTGATTTCAA
Staphylococcus pseudintermedius HKU10-03, complete genome.
CP002439.1:2478572-2478586
TACTGGTCCTGAGTTCGTCTCCATTTTAAG2478572TTCATTGACAACATTAATCGTTGCTGTTGTAACTGCGCGTAAAGG
Desulfobacca acetoxidans DSM 11109, complete genome.
CP002629.1:1520322-1520336
GTCCTGTGGGTCAGCGCCATTGCCAGCGCC1520322TTCATTGACAACATTCCCTTCACGGCGACCATGCTGCCCATAGTG
Clostridium acetobutylicum DSM 1731, complete genome.
CP002660.1:2177171-2177185
GGTATTTTATCTTTATTTACAAAAACAGTC2177171TTCATTGACAACATTATTCTCGAAAGTTCTCCTCCTGATACAATT
Desulfotomaculum ruminis DSM 2154, complete genome.
CP002780.1:2086166-2086180
ATCACCTCTTTTTTTCAGTAGCGAAATAAC2086166TTCATTGACAACATTCATAAGCTGATCTTCACTGATGCCGCTCTC
Pasteurella multocida 36950, complete genome.
CP003022.1:1630845-1630859
CAATTTTAATCTTGTCGCACCTGTCACCAA1630845TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Anabaena sp. 90 chromosome chANA01, complete sequence.
CP003284.1:260790-260804
GTCTTGAGATTCCCAATTTTTAATAATATA260790TTCATTGACAACATTATCTAACCAAAACTCTTCATAACCTTTAGC
Pasteurella multocida subsp. multocida str. HN06, complete genome.
CP003313.1:1640084-1640098
CAATTTTAATCTTGTCGCACCTGTCACCAA1640084TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Pasteurella multocida subsp. multocida str. HB03, complete genome.
CP003328.1:1577598-1577612
CAATTTTAATCTTGTCGCACCTGTCACCAA1577598TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Bacillus cereus FRI-35 plasmid p01, complete sequence.
CP003748.1:213995-214009
ATAGGAACTGTTCCAGCTAACAATACGGTA213995TTCATTGACAACATTCCAGAAGGGACTATATTCATTGAAGATAGC
Acinetobacter baumannii BJAB07104, complete genome.
CP003846.1:1301692-1301706
ATGTTAAGTGATGCACCAGCATTGCAGTCA1301692TTCATTGACAACATTTTGCGCCATGGTCTTGACATCAAGCTTGAA
Acinetobacter baumannii BJAB0868, complete genome.
CP003849.1:1252910-1252924
ATGTTAAGTGATGCACCAGCATTGCAGTCA1252910TTCATTGACAACATTTTGCGCCATGGTCTTGACATCAAGCTTGAA
Acinetobacter baumannii TYTH-1, complete genome.
CP003856.1:1514136-1514150
ATGTTAAGTGATGCACCAGCATTGCAGTCA1514136TTCATTGACAACATTTTGCGCCATGGTCTTGACATCAAGCTTGAA
Pasteurella multocida OH1905, complete genome.
CP004392.1:1111732-1111746
CAATTTTAATCTTGTCGCACCTGTCACCAA1111732TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Candidatus Thioglobus singularis PS1, complete genome.
CP006911.1:875702-875716
ATGAAAAAAATACTATTAACTTTAAAAAAA875702TTCATTGACAACATTAGAAGTACAATTAACTCTTTTGAGAGATAG
Pasteurella multocida subsp. multocida HB01, complete genome.
CP006976.1:1638989-1639003
CAATTTTAATCTTGTCGCACCTGTCACCAA1638989TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Pasteurella multocida subsp. multocida str. HN07, complete genome.
CP007040.1:1614821-1614835
CAATTTTAATCTTGTCGCACCTGTCACCAA1614821TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Pasteurella multocida subsp. multocida PMTB2.1, complete genome.
CP007205.2:1613041-1613055
CAATTTTAATCTTGTCGCACCTGTCACCAA1613041TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Synechocystis sp. PCC 6714, complete genome.
CP007542.1:2598375-2598389
CGGGACGTCAATAAGCAAGATGTGTTGCTC2598375TTCATTGACAACATTTTCCGTTTCGTCCAAGCTGGTTCAGAAGTG
Staphylococcus capitis subsp. capitis strain AYP1020, complete genome.
CP007601.1:2244465-2244479
CCTCTGTAAGAAGCGGGTAGTACAATAGGC2244465TTCATTGACAACATTGACGTTGAAGTTGGTATTTTAAATTCACTT
Bacillus anthracis strain 2000031021, complete genome.
CP007618.1:2493871-2493885
ATCGGAACGGTTCCAGCTAACAATACGGTG2493871TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain delta Sterne genome.
CP008752.1:3969937-3969951
ATCGGAACGGTTCCAGCTAACAATACGGTG3969937TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Pasteurella multocida strain ATCC 43137, complete genome.
CP008918.1:117936-117950
CAATTTTAATCTTGTCGCACCTGTCACCAA117936TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
Paenibacillus sp. FSL H7-0737, complete genome.
CP009279.1:6151569-6151583
CCTGTTCATTTGCGCTTTTTTGCCCGTTCC6151569TTCATTGACAACATTACGTAGCATCATCGTCATTGCCTCTGCGGT
Bacillus cereus D17, complete genome.
CP009300.1:2965749-2965763
ATCGGAACGGTTCCAGCTAACAATACAGTG2965749TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain PAK-1, complete genome.
CP009325.1:3685826-3685840
ATCGGAACGGTTCCAGCTAACAATACGGTG3685826TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain K3, complete genome.
CP009331.1:5150213-5150227
ATCGGAACGGTTCCAGCTAACAATACGGTG5150213TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain SK-102, complete genome.
CP009464.1:4799284-4799298
ATCGGAACGGTTCCAGCTAACAATACGGTG4799284TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain Pasteur, complete genome.
CP009476.1:1233237-1233251
ATCGGAACGGTTCCAGCTAACAATACGGTG1233237TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Methanosarcina vacuolata Z-761, complete genome.
CP009520.1:3962519-3962533
TACCGGAATAATACTGTAATGTTTCATTAC3962519TTCATTGACAACATTTTGATGAATACTTATTTCCTCTTCATCATC
Methanosarcina barkeri str. Wiesmoor, complete genome.
CP009526.1:800853-800867
TACCGGAATAATACTACATTGTTTCATTAC800853TTCATTGACAACATTTTGATGAACATTTATTTCCTCTTCATTATC
Bacillus anthracis str. Sterne, complete genome.
CP009541.1:1099438-1099452
ATCGGAACGGTTCCAGCTAACAATACGGTG1099438TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis strain BA1015, complete genome.
CP009544.1:3348628-3348642
ATCGGAACGGTTCCAGCTAACAATACGGTG3348628TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus cereus strain 3a plasmid pBFC_3, complete sequence.
CP009595.1:169593-169607
ATAGGAACTGTTCCAGCTAACAACACGGTG169593TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
Bacillus cereus strain 3a, complete genome.
CP009596.1:2066774-2066788
ATCGGAACGGTTCCAGCTAACAATACGTTG2066774TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus anthracis str. V770-NP-1R, complete genome.
CP009598.1:3337765-3337779
ATCGGAACGGTTCCAGCTAACAATACGGTG3337765TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus cereus strain S2-8, complete genome.
CP009605.1:2611822-2611836
ATCGGAACGGTTCCAGCTAACAATACGTTG2611822TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence.
CP009606.1:35828-35842
ATAGGAACTGTTCCAGCTAACAACACGGTG35828TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120bct/TTCATTGACAACATT
lang : en | db : ddbj120bct | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.096 | 0.089 | search_plus_done; http://172.18.8.72:27508/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.128 | 0.032 | search_minus_done; http://172.18.8.72:27508/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.128 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).