GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:29:22, GGGenome : DDBJ release 120.0, ENV division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Uncultured Flavobacteriia bacterium.
FO117603.1:16462-16476
AGTTAATGGCATTGGTTACTGGGTTAATAT16462TTCATTGACAACATTCTCACAAATACCTGATAATGAGAATATAAA
Uncultured bacterium clone VISS18_097 genomic sequence.
KX158548.1:16462-16476
AGTTAATGGCATTGGTTACTGGGTTAATAT16462TTCATTGACAACATTCTCACAAATACCTGATAATGAGAATATAAA
Homavirus sp. clone Homavirus_44 genomic sequence.
MK072375.1:2043-2057
ACGATTAGGTGCGGCATTAAGAAAAAACAG2043TTCATTGACAACATTGGATTTGGAAGATAATTACTTCAATAGTGA
Siphoviridae sp. isolate 87, complete genome.
MN855792.1:19506-19520
CTTTCCGGGCAAGACTTTACTAAGCTTGAC19506TTCATTGACAACATTGAAGCCGCTTTTGTTGATTCCGATTCGGAT
Uncultured stramenopile clone AA3F14RJ1F12 18S ribosomal RNA gene, partial sequence.
GU823247.1:964-978
GTTAACGAACGAGACCTTAGCCTGCTAAAT964AATGTTGTCAATGAATATTCATTGGCAGCGTTTCTTAGAGGGACA
Uncultured marine thaumarchaeote KM3_70_D07 genomic sequence.
KF901029.1:9827-9841
TGACCACGTGGGCTCACAACGCTTGCAAGA9827AATGTTGTCAATGAACCACTTCCAGTACCAATTTCAACAATTTTT
Saccharomyces kudriavzevii genome assembly, chromosome: 10.
LR215944.1:468222-468236
TGGTTACTTAATAAGTCATTTTGCTGTAGC468222AATGTTGTCAATGAAGTAAGTTCCGCAAGTAAAGTGGTGTTGAAA
Fisa-like virus clone V17D19D1 polyprotein gene, partial cds.
MG571973.1:1051-1065
CCCCTYGAACGAACAAAGGAATATTATGAG1051AATGTTGTCAATGAAGTTCTCTGTCGTGATCAGGAGCATGTCACT
Viral metagenome isolate GVMAG-M-3300023184-16 genomic sequence.
MN740015.1:212242-212256
GTTACCCTTTTTGAAAATTTGCACATCCAA212242AATGTTGTCAATGAATCGCATTTGTTGTAATATTTTTTCAATATG
Astroviridae sp. isolate tom152ast2, complete genome.
MN920667.1:3801-3815
TCTGGGCAATATTCGACAACTGTAGATAAC3801AATGTTGTCAATGAATGGTTAACAGCGTATGAGTTTGGCTATCTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120env/TTCATTGACAACATT
lang : en | db : ddbj120env | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.121 | 0.114 | search_plus_done; http://172.18.8.77:27512/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.199 | 0.078 | search_minus_done; http://172.18.8.77:27512/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.202 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).