GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:49:11, GGGenome : DDBJ release 120.0, EST division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

25940 Lambda-PRL2 Arabidopsis thaliana cDNA clone 305F5T7, mRNA sequence.
AA394357.1:46-60
CGTGATGCTGAAGGCCAAGACGTTTTGCTT46TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
17 Loblolly pine N Pinus taeda cDNA clone 2N12H, mRNA sequence.
AA556162.1:129-143
CGAGATGCCGAAGGCCAGGATGTGTTGCTC129TTCATTGACAACATTTTCCGTTTTACACAAGCAAACTCTGAAGTG
MCCE3476.M1F Schistosoma mansoni, cercariae Schistosoma mansoni cDNA clone SMC3476 3' end, mRNA sequence.
AA999551.1:228-242
TCACGAAACTTAAACTACCTACTTGTCACA228TTCATTGACAACATTCAGCTGAATGGTGACGGATTCCGGTTTCCC
coau0002F12 Cotton Boll Abscission Zone cDNA Library Gossypium hirsutum cDNA clone coau0002F12 5', mRNA sequence.
AI054854.1:197-211
CGTGATGCAGAAGGGCAGGATGTGCTTCTC197TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTTCTGAAGT
y8h10a1.r1 Aspergillus nidulans 24hr asexual developmental and vegetative cDNA lambda zap library Aspergillus nidulans cDNA clone y8h10a1 5', mRNA sequence.
AI213281.1:56-70
CGTGACGAGGAGGGTCAGGACGTGCTGCTC56TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
NCSC1F11T3 Subtracted Conidial Neurospora crassa cDNA clone SC1F11 5' similar to ATP synthase, beta chain, mitochondrial, N. crassa, mRNA sequence.
AI392300.1:22-36
GAATTCGGCACGACGTTGCTC22TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAAGTG
NCSC3G5T3 Subtracted Conidial Neurospora crassa cDNA clone SC3G5 5' similar to ATP synthase, beta chain, mitochondrial, N. crassa, mRNA sequence.
AI392501.1:409-423
CGTGATGAGGAGGGTCAGGATGTGTTGCTC409TTCATTGACAACATTTTCCGTTTCACCCACGCCGGTTCTGAGGTG
BNLGHi5305 Six-day Cotton fiber Gossypium hirsutum cDNA 5' similar to ATP SYNTHASE BETA CHAIN, MITOCHONDRIAL, mRNA sequence.
AI726218.1:397-411
CGTGATGCAAAAGGGCAGGATGTGCTTCTC397TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG
BNLGHi5214 Six-day Cotton fiber Gossypium hirsutum cDNA 5' similar to ATP SYNTHASE BETA CHAIN, MITOCHONDRIAL, mRNA sequence.
AI729802.1:363-377
CGTGATGCTGAAGGGCAGGATGTGCTTCTC363TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG
Trichoderma atroviride EST, clone L51TP1P005R00464.
AJ912423.1:146-160
TTCGGCCATTACGGCCGGGATGTCCTGCTC146TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCTGAGGTG
Bos indicus 3' EST, clone C0006008g11.
AM037005.1:522-536
CGAAGGGGACAGGGATGTGGGGGGAGCCTC522TTCATTGACAACATTCCTTACTCCA
Brassica oleracea var. alboglabra EST, clone AAFC_WHRI_BoE01a005M17_SP6.
AM057840.1:398-412
CGTGATGCCGAAGGCCAAGATGTGTTGCTT398TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
Lutzomyia longipalpis EST clone SFM-02d05, sequence read SFM-02d05.q1ka.
AM094584.1:804-818
CGTGATCAGGAAGGACAGGATGTATTGCTT804TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGGTTCTGAGGT
Fredericella sultana EST, clone P5D10.
AM110379.1:332-346
TATTCAATTCACTCAAACACAAATACTTCC332TTCATTGACAACATTAAGTTTTCATTTAATCAGAATCGTAAAAAT
Oryzias latipes EST, clone McF0005J16-MGRbd1.
AM138095.1:263-277
TGTAACCCTAACCTGCAGGTCTTCAATGTA263TTCATTGACAACATTGATGAGAGGCTCCCCAGAATCGCTCTGTTC
Picea abies EST, clone K0000400040B11F1.
AM173967.1:145-159
CGAGATGCCGAAGGCCAGGATGTGTTGCTC145TTCATTGACAACATTTTCCGTTTTACACAGGCAAACTCTGAAGTG
Brassica oleracea var. alboglabra EST, clone AAFC_WHRI_BoE02a017B04_T7.
AM391442.1:494-508
CGTGATGCTGAAGGCCAAGATGTGTTGCTT494TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
Cucumis melo subsp. melo EST, clone PS_20-B05-M13R.
AM716755.2:180-194
CGTGATGCTGAAGGACTGGATGTGCTTCTC180TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
Cucumis melo subsp. melo EST, clone CI_22-C08-M13R.
AM734939.2:179-193
CGTGATGCTGAAGGACAGGATGTGCTTCTC179TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
Venerupis (Ruditapes) philippinarum EST, 5' end sequence, clone mge013P0004M17.
AM876147.1:306-320
CGTGACCAGGAAGGCCAGGATGTGTTGCTC306TTCATTGACAACATTTTCAGATTCACACAAGCTGGTTCAGAGGTA
Venerupis (Ruditapes) philippinarum EST, 5' end sequence, clone mge013P0006K07.
AM876814.1:270-284
CGTGACCAGGAAGGCCAGGATGTGTTGCTC270TTCATTGACAACATTTTCAGATTCACACAAGCTGGTTCAGAGGTA
Oryza sativa Japonica Group cDNA, partial sequence (C50587_2A).
AU062818.1:208-222
CCGTGATGCCGAAGACAAGATGTGCTTTTN208TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Oryza sativa Japonica Group cDNA, partial sequence (C50480_7A).
AU093245.1:209-223
CGTGATGCCGAAGGACAAGATGTGCTTTTG209TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Oryza sativa Japonica Group cDNA, partial sequence (E1968_1A).
AU197246.1:257-271
CGTGATGCCGAAGGACAAGATGTGCTTTTG257TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Caenorhabditis elegans cDNA clone:yk756h08 : 5' end, single read.
AU198838.1:392-406
CGTGACCAGGAAGGACAAGATGTGCTTCTT392TTCATTGACAACATTTTCCGTTTCACCCAGGCTGGATCTGAAGTG
Caenorhabditis elegans cDNA clone:yk898h12 : 5' end, single read.
AU208829.1:505-519
CGTGACCAGGAAGGACAAGATGTGCTTCTT505TTCATTGACAACATTTTCCGTTTCACCCAGGCTGGATCTGAAGTG
Oryza sativa Japonica Group Koshihikari cDNA, clone:KP3-0874.
AU225844.1:500-514
CGTGATGCCGAAGGACAAGATGTGCTTTTG500TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Bombyx mori cDNA clone:e96h0862.
AV401548.1:544-558
CGTGATCAAGAAGGACAGGATGTACTGCTC544TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
Bombyx mori cDNA clone:prgv0416.
AV404766.1:597-611
GTGATCAAGAAGGACAGGATGTACTGCTTC597TTCATTGACAACATTTTTCCGTTTCACTCAGGCTGGATTCAGAAG
Arabidopsis thaliana cDNA clone:APZ18f08R, 5' end.
AV526666.1:15-29
AAGATGTCTTGCTT15TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:RZ107b10R, 5' end.
AV550021.1:350-364
CGTGATGCTGAAGGCCAAGACGTTTTGCTT350TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:RZ118e03R, 5' end.
AV550868.1:507-521
CGTGATGCTGAAGGCCAAGATGTCTTGCTT507TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:RZ129a08R, 5' end.
AV551608.1:470-484
CGTGATGCTGAAGGCCAAGACGTTTTGCTT470TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:SQ053a07F, 3' end.
AV556814.1:51-65
CGTGATGCTGAAGGCCAAGATGTCTTGCTT51TTCATTGACAACATTTTCCGTTTCACTAAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:SQ066b05F, 3' end.
AV557336.1:113-127
CGTGATGCTGAAGGCCAAGATGTCTTGCTT113TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana cDNA clone:SQ182h07F, 3' end.
AV563191.1:51-65
CGTGATGCTGAAGGCCAAGATGTCTTGCTT51TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
ST34F10 Pine TriplEx shoot tip library Pinus taeda cDNA clone ST34F10, mRNA sequence.
AW064699.1:230-244
AAGATGCCGAAGGGCAAGGATGTGTTGCTC230TTCATTGACAACATTTTCCGTTTTACACAAAGCAAAACTCCTGAA
bl18b05.w1 Blackshear/Soares normalized Xenopus egg library Xenopus laevis cDNA clone PBX0018B05 5', mRNA sequence.
AW634146.1:55-69
AGAGATCAAGAGGGACAAGATGTGTTGCTT55TTCATTGACAACATTTTCAGGTTCACCCAGGCTGGTTCAGAGGTG
Bombyx mori cDNA, clone:E_ET_psgV_10H03_F_0, 5' end sequence.
BB988320.1:139-153
CGTGATCAAGAAGGACAGGATGTACTGCTC139TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
IpHdk00275 Head kidney cDNA library Ictalurus punctatus cDNA 5' similar to ATP synthase beta-subunit, mRNA sequence.
BE469082.1:113-127
CGTGATCAGGAGGGACAGGACGTGCTGCTT113TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
M16B5STM Arabidopsis developing seed Arabidopsis thaliana cDNA clone M16B5 5', mRNA sequence.
BE520998.1:214-228
CGTGATGCTGAAGGCCAAGATGTCTTGCTT214TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
M32B11STM Arabidopsis developing seed Arabidopsis thaliana cDNA clone M32B11 5', mRNA sequence.
BE523083.1:201-215
CGTGATGCTGAAGGCCAAGATGTCTTGCTT201TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
an_3252 Aspergillus niger, pYES2 (XhoI-EcoRI) Aspergillus niger cDNA clone 3252 5', mRNA sequence.
BE758985.1:2-16
C2TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
NXCI_133_B11_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda cDNA clone NXCI_133_B11 5' similar to Arabidopsis thaliana sequence At5g08680 H+-transporting ATP synthase beta chain (mitochondri
BF186138.1:85-99
CGAGATGCCGAAGGCCAGGATGTGTTGCTC85TTCATTGACAACATTTTCCGTTTTACACAAGCAAACTCTGAAGTG
602137981F1 NIH_MGC_83 Homo sapiens cDNA clone IMAGE:4274229 5', mRNA sequence.
BF674822.1:338-352
GATCCCCTCGAAGACTACTCTGTTACCAGG338TTCATTGACAACATTTCAAAAGCTTACAAAAAAACAGAACAGACA
NXSI_096_A10_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA clone NXSI_096_A10 5' similar to Arabidopsis thaliana sequence At5g08680 H+-transporting ATP synthase beta chain (mitochondrial) -li
BG039201.1:23-37
CGAAGGCCAGGATGTGTTGCTC23TTCATTGACAACATTTTCCGTTTTACACAAGCAAACTCTGAAGTG
EST471016 tomato shoot/meristem Solanum lycopersicum cDNA clone cTOF8M10 5' sequence, mRNA sequence.
BG125370.1:271-285
AACAAAATAATTGACTCTAAGCTAAAATAA271TTCATTGACAACATTTTCTTGCCATGTCCTTGTGTAAATGATCTC
S10-1-D6 Stage 10+ Gastrula Library Xenopus laevis cDNA 5' similar to ATP synthase BETA CHAIN (partial) mitochondrial, mRNA sequence.
BG409503.1:582-596
AGAGATCAAGAGGGACAAGATGTGTTGCTT582TTCATTGACAACATTTTCAGGTTTACCCAGGCTGGATCAGAGGTA
GA__Ea0011A22f Gossypium arboreum 7-10 dpa fiber library Gossypium arboreum cDNA clone GA__Ea0011A22f, mRNA sequence.
BG440940.1:166-180
CGTGATGCTGAAGGGCAGGATGTGCTTCTC166TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG
GA__Ea0014J21f Gossypium arboreum 7-10 dpa fiber library Gossypium arboreum cDNA clone GA__Ea0014J21f, mRNA sequence.
BG441779.1:174-188
CGTGATGCTGAAGGGCAGGATGTGCTTCTC174TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120est/TTCATTGACAACATT
lang : en | db : ddbj120est | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.384 | 0.377 | search_plus_done; http://172.18.8.73:27514/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.414 | 0.031 | search_minus_done; http://172.18.8.73:27514/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.415 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).