GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:27:33, GGGenome : DDBJ release 120.0, GSS division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Mus musculus molossinus DNA, clone:MSMg01-304I21.T7, genomic survey sequence.
AG429799.1:1495-1509
CGTCCTATTGCATATTGTATATGTATATGA1495TTCATTGACAACATTTCTCAGTGTTATTCGATTAGTATATTATAN
Oryza sativa Indica Group genomic DNA, BAC end sequence, BAC clone:K0415E08_R.
AG897509.1:417-431
CGTGTGCCTCCTGGATGCACCAATCGGCTG417TTCATTGACAACATTTTGTTGAAGGACCTTGGGCACATCTTTTTG
Hemicentrotus pulcherrimus BAC clone: BUB1-14M13_R, 3'end.
AG990527.1:71-85
CGAGGNNNGNNTGAGTTTTGACTTGTGATT71TTCATTGACAACATTGATTCTACGACCTTAAACGTTGGGAATACA
T7 end of clone 021AC09 of library SmBAC1 from strain Puerto-Rican of Schistosoma mansoni.
AL619317.1:862-876
CACGAAACTTAAACCACCTACCTTGTCACA862TTCATTGACAACATTCAGCTGTATGGGAATCCM
HS_2026_B2_A05_T7C CIT Approved Human Genomic Sperm Library D Homo sapiens genomic clone Plate=2026 Col=10 Row=B, genomic survey sequence.
AQ767179.1:102-116
AGAGAATCTAAATGTGTTAATCTTATACAT102TTCATTGACAACATTCAGGTGCTATAAAAGAATTCATATACAATA
1M0497I09R Mouse 10kb plasmid UUGC1M library Mus musculus genomic clone UUGC1M0497I09 R, genomic survey sequence.
AZ637985.1:62-76
TGAACACATTCTCCCTGTTTGTGTCATCAC62TTCATTGACAACATTTAACTGGGCCTTCTGTGTGGATACCATGAT
021_E_17-21 SmBAC1 Schistosoma mansoni genomic clone 021E17 5', genomic survey sequence.
BH182368.1:862-876
CACGAAACTTAAACCACCTACCTTGTCACA862TTCATTGACAACATTCAGCTGTATGGGAATCCM
BOGQM31TR BOGQ Brassica oleracea genomic clone BOGQM31, genomic survey sequence.
BH566806.1:303-317
ATAACTACTTAAAAGTAAAAAATCATATCG303TTCATTGACAACATTTGGGTTGAAAAACTTATTTATAAATGCCAA
odg61a04.b1 B.oleracea002 Brassica oleracea genomic, genomic survey sequence.
BH982618.1:585-599
CGTACACGTCTTCTTGGTGTAGCTGATGAT585TTCATTGACAACATTCATCACGTCCATGCGCAAGTAGTCACCAAT
Danio rerio genomic clone DKEY-91L5, genomic survey sequence.
BX141546.1:345-359
GCGTCTGTTGCGGCGAAACTGTTGTCCTGC345TTCATTGACAACATTGTATGACCTTGGCTCATTTCTTTTTGAAAC
Danio rerio genomic clone DKEY-127P13, genomic survey sequence.
BX167931.1:562-576
CGGAGCGCAGGTTGAGATCTCCTTGCTGGT562TTCATTGACAACATTTCCGGCAGAAGCCTAGCTTTTCCCATGTGG
lkh10d05.b1 B.oleracea002 Brassica oleracea genomic, genomic survey sequence.
BZ087056.1:633-647
ATACTAATGGCTACTTGATTGCCCTCTTGC633TTCATTGACAACATTGGATTGGCCAATTTTTCCTTCACCATTTAA
CH230-520K10.TV CHORI-230 Segment 2 Rattus norvegicus genomic clone CH230-520K10, genomic survey sequence.
BZ258580.1:392-406
GAAGCTAATAGTGCAATCCGCATGGTCTCC392TTCATTGACAACATTAACAGCTGTAATAAAATCAAGATATTGGCA
BONCU32TR BO_1.6_2_KB_tot Brassica oleracea genomic clone BONCU32, genomic survey sequence.
BZ482258.1:591-605
CGTGATGCCGAAGGCCAAGATGTGTTGCTT591TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTCTGTTCTT
PUGDZ12TB ZM_0.6_1.0_KB Zea mays genomic clone ZMMBTa362B24, genomic survey sequence.
BZ826104.1:624-638
CCTAATACCAAATTCTGTGTTCCACATCAT624TTCATTGACAACATTCATCAACTCTTGAATGGAAGCCTTCTCTCT
PUGGR72TB ZM_0.6_1.0_KB Zea mays genomic clone ZMMBTa380K24, genomic survey sequence.
BZ977853.1:257-271
CCTAATAGCAAATTCCGTGTTCCACATCAT257TTCATTGACAACATTCATCAACTCTTGAATGGAAGCCTTCTCTCT
NDL.28K22.T7 Notre Dame Liverpool Aedes aegypti genomic clone NDL.28K22, genomic survey sequence.
CC129459.1:363-377
AAAAGTGCATCGAAAATACTGCGTTCAATT363TTCATTGACAACATTTGCAGAGATCTTTGAACTGCTTTGGCCGTT
CH261-83O17_Sp6.1 CH261 Gallus gallus genomic clone CH261-83O17, genomic survey sequence.
CC222036.1:416-430
TGCAGCAAATATTTTAAAGAAAACATGAAA416TTCATTGACAACATTTAATCAACAAATATTATTCAACCTTATTTG
PUHRC85TB ZM_0.6_1.0_KB Zea mays genomic clone ZMMBTa515O01, genomic survey sequence.
CC410912.1:348-362
CCTAATACCAAATTCTGTGTTCCACATCAT348TTCATTGACAACATTCATCAACTCTTGAATGGAAGCCTTCTCTCT
ZMMBBb0125N11.r ZMMBBb Zea mays subsp. mays genomic clone ZMMBBb0125N11 3', genomic survey sequence.
CC747628.1:502-516
AAGCCCGAATTAGACAAGTTTGTGGTGGTC502TTCATTGACAACATTTTGATCTATTCCAAGAATGAGGAGGAGCAT
NDL.56L11.SP6 Notre Dame Liverpool Aedes aegypti genomic clone NotreDame Liverpool-56L11, genomic survey sequence.
CC854470.1:326-340
AAAAGTGCATCGAAAATACTGCGTTCAATT326TTCATTGACAACATTTGCAGAGATCTTTGAACTGCTTTGGCCGTT
tigr-gss-dog-17000333871824 Dog Library Canis lupus familiaris genomic, genomic survey sequence.
CE292581.1:317-331
AATAAATTGAAAAGGACAAAGAGAATTTCA317TTCATTGACAACATTTTGTAAAATTATTTTATTTATTTATTTTAC
tigr-gss-dog-17000368574337 Dog Library Canis lupus familiaris genomic, genomic survey sequence.
CE691095.1:103-117
GTGTTATGTATACTTAAATACATAGCCTGT103TTCATTGACAACATTCTCTGGTGTTTCGGCCTCTCTTTTTTTCCT
tigr-gss-dog-17000315419960 Dog Library Canis lupus familiaris genomic, genomic survey sequence.
CE730781.1:71-85
ATTAAAGGAGATTAGTGTTAACATTTGGTT71TTCATTGACAACATTTAAATGAAAACATTCCTAGTCAGTGGGAAT
PUFZQ49TD ZM_0.6_1.0_KB Zea mays genomic clone ZMMBTa0769J01, genomic survey sequence.
CG150819.1:375-389
ATGGAAGAGTTAGATAAGTTTGTCGTAGTC375TTCATTGACAACATTCTCATCTACTCCAAGAGTCAACAGGAGCAT
OR_BBa0021J15.r OR_BBa Oryza sativa f. spontanea genomic clone OR_BBa0021J15 3', genomic survey sequence.
CL625609.1:198-212
CGTGTGCCTCCTGGATGCACCAATCGGCTG198TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
OR_BBa0068D17.f OR_BBa Oryza sativa f. spontanea genomic clone OR_BBa0068D17 5', genomic survey sequence.
CL734871.1:669-683
CGTGTGCCTCCTGGATGCACCAATCGGCTG669TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
OR_BBa0079G16.r OR_BBa Oryza sativa f. spontanea genomic clone OR_BBa0079G16 3', genomic survey sequence.
CL743153.1:668-682
CGTGTGCCTCCTGGATGCACCAATCGGCTG668TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
OR_CBa0013E05.r OR_CBa Oryza rufipogon genomic clone OR_CBa0013E05 3', genomic survey sequence.
CL801351.1:30-44
CATTGAACATTTATGTAGCGAACAAACAG30TTCATTGACAACATTTTGCAAAGTAGGTAGGGGTGCTCAATCATA
OR_CBa0024B18.f OR_CBa Oryza rufipogon genomic clone OR_CBa0024B18 5', genomic survey sequence.
CL809348.1:198-212
CGTGTGCCTCCTGGATGCACCAATCGGCTG198TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
OsIRUA003836 Oryza sativa Express Library Oryza sativa Indica Group genomic, genomic survey sequence.
CL950189.1:19-33
GCACGAGGGAACAAACAG19TTCATTGACAACATTTTGCAAAGTAGGTAGGGGTGCTCAAGCATA
OsIFCC022016 Oryza sativa Express Library Oryza sativa Indica Group genomic, genomic survey sequence.
CL971731.1:859-873
CGTGATGCCGAAGGACAAGATGTGCTTTTG859TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Arabidopsis thaliana T-DNA flanking sequence GK-719B07-025279.
CR357328.1:97-111
CGTGATGCTGAAGGCCAAGACGTTTTGCTT97TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCCTTGTTCCT
Arabidopsis thaliana T-DNA flanking sequence GK-719B07-025308.
CR357329.1:102-116
CGTGATGCTGAAGGCCAAGACGTTTTGCTT102TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCCTTGTTCCT
GR0AAA15DC03FM1 INRA BAC Bos taurus genomic clone INRAb_286C03, DNA sequence.
CR797373.1:711-725
CAGTGACTCCCCCTGACTCACTGCTTTAAA711TTCATTGACAACATTTTTTAAAAGGTAGAGAATTCTCATGAAGAG
GR0AAA71CF04RM1 INRA BAC Bos taurus genomic clone INRAb_918D12, DNA sequence.
CR837170.1:142-156
AGGGAATTCCAGAAAAACATCTACTTCCAT142TTCATTGACAACATTAAAGCCTTTGACTCTGTGGGTGAAAAATTC
104_783_11463335_148_36246_096 Sorghum methylation filtered library (LibID: 104) Sorghum bicolor genomic clone 11463335, genomic survey sequence.
CW299853.1:188-202
CACCTATGTACAGTTAATATTGCTTATCAG188TTCATTGACAACATTGCCCCACAGTGTATGGTGCTGAAATCCTGA
OA_ABa0135J24.r OA_ABa Oryza australiensis genomic clone OA_ABa0135J24 3', genomic survey sequence.
CW598640.1:293-307
ATGGAATACTTGGATAAGTTTGTTATTGTT293TTCATTGACAACATTCTCATCTACTCCAAGGATGAAAATGAGCAT
OA_ABa0186G07.r OA_ABa Oryza australiensis genomic clone OA_ABa0186G07 3', genomic survey sequence.
CW647308.1:286-300
ATGGAATACTTGGATAAGTTTGTTATTGTT286TTCATTGACAACATTCTCATCTACTCCAAGGATGAAAATGAGCAT
OA_BBa0031F11.f OA_BBa Oryza alta genomic clone OA_BBa0031F11 5', genomic survey sequence.
CZ136780.1:143-157
GATGGACAGTACATATATATTCCTGAAAAT143TTCATTGACAACATTGCATCCAATAGACATTTGCCAGGATTACGA
OA_BBa0034I01.r OA_BBa Oryza alta genomic clone OA_BBa0034I01 3', genomic survey sequence.
CZ138971.1:30-44
CATTGAACATTTATGTAGCGAACAAACAG30TTCATTGACAACATTTTGCAAAGTAGGTAGGGGTGCTCAATCATA
SRAA-aad22b01.g1 Strongyloides ratti whole genome shotgun library (SRAAGSS 004) Strongyloides ratti genomic, genomic survey sequence.
CZ538826.1:719-733
CGTGATCAAGAAGGACAAGATGTACTTCTT719TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAAGTA
OC__Ba0008N24.f OC__Ba Oryza coarctata genomic clone OC__Ba0008N24 5', genomic survey sequence.
CZ695580.1:14-28
ACAGCGAGATCAT14TTCATTGACAACATTTTTGGTGATATAAGAAAGTGGGTGACAACT
Oryzias latipes DNA, clone: ola1-116J03.R, genomic survey sequence.
DE250217.1:80-94
AATGTGGCAGATCTGAAGGATGTTGTGGAG80TTCATTGACAACATTTCTTGGAGCATTAAAAACATATACCAGTAA
Bombyx mori genomic DNA, BAC clone:BET_016_B23.
DE334697.1:603-617
CGGGTAGTGTTATTGTTAGAACATAGGACA603TTCATTGACAACATTATCAAG
Bombyx mori genomic DNA, Fosmid clone:GBMFno206_m06.b1.
DE564221.1:9-23
TAGAATTT9TTCATTGACAACATTACGGAGTGAACTAACACAATGATACATAGA
Macropus eugenii DNA, BAC clone: MEB1-071P08_F, 5'end.
DE894182.1:360-374
GGTCGTGGTGTGAGGGCTATAAAGAGTGAA360TTCATTGACAACATTCTAATGTTTTTCAGTGATAAAACAAAACAG
212482 Tomato MboI BAC Library Solanum lycopersicum genomic clone SL_MboI0117I20 5, genomic survey sequence.
DU950308.1:130-144
AAACCATTTCTGGATTCTTTTTTCATCATC130TTCATTGACAACATTTTGGTTTATTCGCAGAGTAAGGATGAGAAT
OR_ABa0216K08.f OR_ABa Oryza ridleyi genomic clone OR_ABa0216K08 5', genomic survey sequence.
DX305746.1:568-582
GACAACGTTCTAGACAAATTTGGCATGGTC568TTCATTGACAACATTCTTATCTATTCCACAACGAAGGAAGAACAT
CHORI103-8P10.TV CHORI103 Schistosoma mansoni genomic clone CHORI103-8P10, genomic survey sequence.
DX988859.1:613-627
AGAAGAAGAAATTGAAAGTGAAGAATTCAA613TTCATTGACAACATTTCAATCATGTAATACTGAAAAGAATTTAAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120gss/TTCATTGACAACATT
lang : en | db : ddbj120gss | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.694 | 0.687 | search_plus_done; http://172.18.8.76:27516/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.724 | 0.030 | search_minus_done; http://172.18.8.76:27516/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.724 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).