GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 10:36:20, GGGenome : DDBJ release 120.0, HUM division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Human BAC clone GS1-312P20 from 5p15.2, complete sequence.
AC002123.1:133597-133611
CCTGGGTATAATGCACTGATCTGCTGATCT133597TTCATTGACAACATTGCCATCGACTTTGGAGCTGGAAAGGCCCTC
Human BAC clone CTB-191D16, complete sequence.
AC002460.1:73482-73496
CAGAATATATTATCGCTTTAAACACAGATT73482TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
Homo sapiens chromosome 19 clone CTD-2356P16, complete sequence.
AC008962.9:39696-39710
AAGCCACCACACCCGGCCTATCTTAGCTTT39696TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Homo sapiens chromosome 8, clone CTC-386L14, complete sequence.
AC090816.3:66203-66217
GTATTTTTAAATTCATCGATATTTCCACTT66203TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Homo sapiens chromosome 3 clone RP11-421B21 map 3p, complete sequence.
AC090949.2:117016-117030
ATTGTAATAGCCAGAAATTGGAAACATATA117016TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Homo sapiens chromosome 5 clone CTD-2105K20, complete sequence.
AC091838.2:60349-60363
CCTGGGTATAATGCACTGATCTGTTGATCT60349TTCATTGACAACATTGCCATCGACTTTGGAGCTGGAAAGGCCCTC
Homo sapiens BAC clone RP11-340B18 from 4, complete sequence.
AC097502.3:52626-52640
AAAAACGTCTGATTTTGTGTAACACTCCTT52626TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
Homo sapiens BAC clone RP11-182K3 from 2, complete sequence.
AC104598.4:73478-73492
ATTGCAGCAAAGAAGCACATTTATATTCTA73478TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
Homo sapiens 3 BAC RP11-474M18 (Roswell Park Cancer Institute Human BAC Library) complete sequence.
AC107025.3:78694-78708
TTGGTTTTGTATATATTAAATAGTTGAAAC78694TTCATTGACAACATTAAGTTTGTTTTCTAGGCTCTATTGGGATAA
Homo sapiens BAC clone RP11-452J21 from 4, complete sequence.
AC108063.3:105748-105762
AACGAAAGGCGTTTGAGGAAAGCCTGATAA105748TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
Homo sapiens chromosome 18, clone RP11-784B15, complete sequence.
AC117569.3:88246-88260
ATATTTATATATGTATATATTTCATATTAT88246TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
Homo sapiens neuregulin 1 (NRG1) gene, partial cds, alternatively spliced.
AF491780.1:103463-103477
GTATTTTTAAATTCATCGATATTTCCACTT103463TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Human DNA sequence from clone RP11-170N11 on chromosome 1.
AL354654.15:105182-105196
CTAATTAATGAATAGTAAGTATATTTTCTC105182TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
Human DNA sequence from clone RP11-173B15 on chromosome 6.
AL360220.12:37485-37499
CTATTTCAATCAACCATCTTGTAATCATAC37485TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
Human DNA sequence from clone RP11-661D17 on chromosome 13.
AL445604.9:147395-147409
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA147395TTCATTGACAACATTTCCTGAGGTAACTCACACTGAGGTGACAAC
Homo sapiens PAC clone RP5-982C16 from 7, complete sequence.
AC004547.1:33513-33527
AACTAACACCCATAAAAGGTATGACTCTTT33513AATGTTGTCAATGAAGATTTAACATAATATTCTATAACAAATATA
Homo sapiens clone RP11-225G18 from 7p14-15, complete sequence.
AC007350.1:94097-94111
TCTACAGATTTTGGATTTACCAGCCCCCAC94097AATGTTGTCAATGAATTCCTTAAAATCTCTCTCTCTCTCTCTCTC
Homo sapiens, clone RP11-84A1, complete sequence.
AC007511.8:14923-14937
ACTCACTGGATCCAATCAGCATAATGTCAT14923AATGTTGTCAATGAAAAGAGTTGAACTCTGTAAAATATTTGAAGA
Homo sapiens chromosome 19 clone CTC-490E21, complete sequence.
AC008537.5:115366-115380
CTCCCTTAGGAGAGCTGTTAACATTATACT115366AATGTTGTCAATGAAAAAGCTAAGATAGGCCAGGCATGGTGGCTC
Homo sapiens BAC clone RP11-387H5 from 2, complete sequence.
AC020571.9:33887-33901
AATGCCCCACATTTCATTAAGGGTGATGAC33887AATGTTGTCAATGAAGAAGTTGCTTCTCATATAACTATACTGTCA
Homo sapiens chromosome 11, clone RP11-72C9, complete sequence.
AC067902.6:101358-101372
CTTTTCTCTATTCACTGTCCTCAATGCTAG101358AATGTTGTCAATGAACAAGACATATCTATGTTCCAGGAAACTCAA
Homo sapiens chromosome 8, clone RP11-566H8, complete sequence.
AC068672.11:2480-2494
TTTGAAAAAAGAGACACAATAAAACTTAAT2480AATGTTGTCAATGAAAAGTGGAAATATCGATGAATTTAAAAATAC
Homo sapiens 12 BAC RP3-361K10 (Roswell Park Cancer Institute Human BAC Library) complete sequence.
AC073616.17:74518-74532
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA74518AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
Homo sapiens BAC clone RP11-348A21 from 7, complete sequence.
AC079231.6:83390-83404
TCTTCTCAGGCAATATTTGTTGAACGAACC83390AATGTTGTCAATGAAGCTAATGAGCTGACTCAGGCCAGGCACCAC
Homo sapiens chromosome 3 clone RP11-321I9 map 3p, complete sequence.
AC087590.2:119880-119894
GGACTATTATATGACTATATTATAATCTTA119880AATGTTGTCAATGAATATATGTTTCCAATTTCTGGCTATTACAAT
Homo sapiens chromosome 3 clone RP11-241K3, complete sequence.
AC093928.2:30245-30259
GCCTGTTTTTCATATGCATATGTAATAGGG30245AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
Homo sapiens 3 BAC RP11-529P9 (Roswell Park Cancer Institute Human BAC Library) complete sequence.
AC117470.8:37788-37802
AATTTGAATATTAATTTTAAAATTTATTCA37788AATGTTGTCAATGAACATTGTCAGACATTTTGCAGCATTTCTTTA
Homo sapiens FOSMID clone ABC27-1763L3 from chromosome 19, complete sequence.
AC240664.3:26187-26201
CTCCCTTAGGAGAGCTGTTAACATTATACT26187AATGTTGTCAATGAAAAAGCTAAGATAGGCCAGGCATGGTGGCTC
Homo sapiens.
AH010218.2:780-794
CTCCCTTAGGAGAGCTGTTAACATTATACT780AATGTTGTCAATGAAAAAGCTAANNNNNNNNNNNNNNNNNNNNNN
Homo sapiens.
AH010219.2:779-793
CTCCCTTAGGAGAGCTGTTAACATTATACT779AATGTTGTCAATGAAAAAGCTAANNNNNNNNNNNNNNNNNNNNNN

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120hum/TTCATTGACAACATT
lang : en | db : ddbj120hum | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.073 | search_plus_done; http://172.18.8.77:27501/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.092 | 0.013 | search_minus_done; http://172.18.8.77:27501/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=35
0.100 | 0.008 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).