GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:27:11, GGGenome : DDBJ release 120.0, INV division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Drosophila melanogaster 3L BAC RPCI98-25O1 (Roswell Park Cancer Institute Drosophila BAC library) complete sequence.
AC010066.9:82672-82686
CGCGACGTGGACGGGCAGGATGTGCTGCTC82672TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Daphnia pulex clone JGIAZSN-5K3, complete sequence.
AC167686.2:16544-16558
AAGTCGAAAAAGATTGAGACGAAACATCAT16544TTCATTGACAACATTTGCCCATAGGGTGTAATAATACGCTACGTT
Trichinella spiralis BAC clone TS195-2H12 from chromosome unknown, complete sequence.
AC189676.2:51234-51248
ACCAACTTTATTCAATATATAATTAGCCAT51234TTCATTGACAACATTGCCAAGATGAACTTCTATCTGAAGTAGAGA
Drosophila melanogaster chromosome 3L.
AE014296.5:16099164-16099178
CGCGACGTGGACGGGCAGGATGTGCTGCTC16099164TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Eurypelma californicum mRNA for hemocyanin subunit f (hcF gene).
AJ277491.1:1160-1174
AGGGATCCGATCTTCTACAGGTACCATCGA1160TTCATTGACAACATTTTCCAGGAGTACAAGGCAACTCTTCCATGC
Thelaxes suberi partial atpD gene for ATPase beta subunit.
AJ296761.1:271-285
AGAGATCAAGAAGGTCAAGATGTATTACTT271TTCATTGACAACATTTTCCGTTTTACTCAAGCTGGTTCTGAAGTA
Panaphis juglandis partial atpD gene for ATPase beta subunit.
AJ296762.1:271-285
AGAGATCAAGAAGGACAGGATGTATTGCTT271TTCATTGACAACATTTTCCGTTTTGCTCAAGCCTGGTCCGAAGTG
Toxoplasma gondii RH strain tachyzoite stage cDNA clone: XTG02692, full cDNA, Sugano cDNA library.
AK223658.1:1012-1026
ATAACATCTGCCCAACACATCTGACATTCC1012TTCATTGACAACATTTCTAGAGACCCGATATCCTTACACAAAACA
Bombyx mori mRNA, clone: fphe23C21.
AK386151.1:931-945
CGTGATCAAGAAGGACAGGATGTACTGCTC931TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
Papilio xuthus mRNA for ATP synthase-beta, complete cds, sequence id: Px-0234.
AK401213.1:940-954
CGTGACCAGGAGGGTCAGGATGTGCTGCTC940TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCTGAAGTG
Papilio polytes mRNA for ATP synthase-beta, complete cds, sequence id: Pp-0189.
AK402408.1:928-942
CGTGATCAGGAGGGTCAGGATGTACTGCTC928TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAAGTG
Papilio polytes mRNA for ATP synthase-beta, complete cds, sequence id: Pp-0315.
AK402480.1:964-978
CGTGATCAGGAGGGTCAGGATGTACTGCTC964TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
Riptortus pedestris mRNA for ATP synthase-beta, complete cds, sequence id: Rped-0378.
AK417201.1:938-952
CGTGACCAAGAAGGACAAGATGTACTGCTT938TTCATTGACAACATTTTCAGATTCACCCAGGCTGGTTCAGAGGTA
Toxoplasma gondii RH, genomic DNA chromosome Ib.
AM055943.1:74489-74503
ATAACATCTGCCCAACACATCTGACATTCC74489TTCATTGACAACATTTCTAGAGACCCGATATCCTTACACAAAACA
Caenorhabditis sp. 34 TK-2017 DNA. chromosome 5, nearly complete genome.
AP018155.1:7438608-7438622
TTTCCACATTTTCAAAGAAGTCGTTCTGTT7438608TTCATTGACAACATTCTTCACAATTTTGATTCTTATTTTGAGTTT
Drosophila melanogaster AT04467 full insert cDNA.
AY089257.1:1112-1126
CGCGACGTGGACGGGCAGGATGTGCTGCTC1112TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Sarcophaga crassipalpis putative ATP synthase-beta subunit mRNA, partial cds; nuclear gene for mitochondrial product.
AY309458.1:28-42
GATCAAGAAGGCCAAGATGTATTGCTT28TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTA
Chaetopterus sp. KJP-2000 ATP synthase beta subunit mRNA, partial cds.
AY580182.1:679-693
CGTGACCACGAGGGTCAGGACGTGCTGCTT679TTCATTGACAACATTTTCCGTTTCACACAGGCTGGCTCTGAGGTG
Enallagma aspersum ATP synthase beta subunit mRNA, partial cds.
AY580209.1:556-570
CGTGATCAGGAAGGACAGGATGTGCTGCTT556TTCATTGACAACATTTTCAGGTTCACCCAAGCTGGTTCAGAGGTG
Lestes congener ATP synthase beta subunit mRNA, partial cds.
AY580223.1:556-570
CGTGATCAGGAGGGTCAGGATGTGCTGCTC556TTCATTGACAACATTTTCAGATTCACTCAGGCTGGTTCAGAGGTG
Monosiga brevicollis ATP synthase beta subunit mRNA, partial cds.
AY580306.1:673-687
TTCCGTGACCAGGGCCGTGACGTGCTTCTC673TTCATTGACAACATTTTCCGTTTCACCCAGGACGGTTCGGAAGTG
Drosophila busckii chromosome X sequence.
CP012528.1:10183298-10183312
ATTAATACACAAATTAGTAAAAAACACAAC10183298TTCATTGACAACATTAAATGCGCAGCCAGCTAAACTTTGAACAAT
Drosophila melanogaster strain sitter (fors) chromosome 3L.
CP023331.1:16092255-16092269
CGCGACGTGGACGGGCAGGATGTGCTGCTC16092255TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain rover (forR) chromosome 3L.
CP023337.1:16092216-16092230
CGCGACGTGGACGGGCAGGATGTGCTGCTC16092216TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Haemonchus contortus strain NZ_Hco_NP chromosome 3.
CP035802.1:13080752-13080766
CGAGACAAAGAAGGACAGGATGTGCTTCTC13080752TTCATTGACAACATTTTCCGTTTCACACAGGCTGGTTCTGAAGTA
Haemonchus contortus strain NZ_Hco_NP chromosome 5.
CP035803.1:9618307-9618321
TAAGGGACCATATTATCCATATCAATAAAA9618307TTCATTGACAACATTCCACTACGAATTGTGTCTTTAGGTTCGACT
Haemonchus contortus strain NZ_Hco_NP chromosome 4.
CP035804.1:73340120-73340134
CTTTCCAGTTGATGCAGCTCGAATAGCAGC73340120TTCATTGACAACATTAGATATATCAGCACCTACGATTTAAGAGCG
Caenorhabditis elegans strain CB4856 chromosome III.
CP038189.1:5492222-5492236
CGTGACCAGGAAGGACAAGATGTGCTTCTT5492222TTCATTGACAACATTTTCCGTTTCACCCAGGCTGGATCTGAAGTG
Caligus rogercresseyi isolate FCH chromosome 4.
CP045893.1:6967402-6967416
TCCTAGGTCAATTAGAAGTTTGATAATCTA6967402TTCATTGACAACATTCAAAGTACAGCTCTTGAAGCTCCGAGAACT
Caligus rogercresseyi isolate FCH chromosome 16.
CP045905.1:12033418-12033432
AGCCATAAATTTGAAATGATTCATTTCTCC12033418TTCATTGACAACATTCTCTACAAGTTAACATTCTACTACTAAAGG
Crassostrea gigas strain QD chromosome 2.
CP048840.1:3784390-3784404
CAAAAACATTGCCTGACTAAAAAAATTTTT3784390TTCATTGACAACATTTATCAATTATTTTGTAAGAAATAAATCTGA
Crassostrea gigas strain QD chromosome 3.
CP048841.1:5395229-5395243
TCTTCTTATGAATACTCCAAACATGGTTCA5395229TTCATTGACAACATTGTTATTTTGTTTTTAAGACTAGTCAGGTAT
Crassostrea gigas strain QD chromosome 4.
CP048842.1:27187994-27188008
ACTTTCTGAAAGAAAAATAATGATAATATG27187994TTCATTGACAACATTATTTTAAAATTTTTATTCCTATATATGCAT
Crassostrea gigas strain QD chromosome 6.
CP048844.1:16817205-16817219
TCTTCTTATGAATACTCCAAACATGGTTCA16817205TTCATTGACAACATTGTTATTTGTTTTTAAGACTAGTCAGGTATA
Crassostrea gigas strain QD chromosome 6.
CP048844.1:41366081-41366095
ATTGGCCGAAGCCTTGCTGATATATGTAGC41366081TTCATTGACAACATTTTTACAAAGCGTAATGTTTTTTCACTTCAT
Crassostrea gigas strain QD chromosome 7.
CP048845.1:12643412-12643426
TCTTCTTATGAATACTCCAAACATGGTTCA12643412TTCATTGACAACATTGTTATTTTGTTTTTAAGACTAGTCAGGTAT
Crassostrea gigas strain QD chromosome 8.
CP048846.1:28851584-28851598
TCTTCTTTTAAATACTCCAAACATGGTTCA28851584TTCATTGACAACATTGTTATTTTGTTTTTAAGACTAGTCAGGTAT
Amphiporus angulatus ATP synthase beta subunit mRNA, partial cds.
DQ087438.1:679-693
CGTGACCAGAAGGGACAGGACGTGCTTCTC679TTCATTGACAACATTTTCAGATTCACACAGGCTGGTTCAGAGGTA
Cerebratulus lacteus ATP synthase beta subunit mRNA, partial cds.
DQ087446.1:679-693
CGTGACCAAGAAGGACAAGATGTGCTACTT679TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGTTCAGAGGTA
Nereis vexillosa ATP synthase beta subunit mRNA, partial cds.
DQ087492.1:679-693
CGTGATATAGAGGGACAGGATGTGTTGCTT679TTCATTGACAACATTTTCAGATTCACACAGGCTGGTTCTGAGGTA
Pinctada fucata ATP synthase beta subunit mRNA, complete cds.
DQ358698.1:914-928
CGTGATCAAGAAGGACAGGACGTGCTGCTT914TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCAGAGGTG
Pacifastacus leniusculus F1-ATP synthase beta subunit mRNA, complete cds.
DQ874396.1:917-931
CGTGATCAAGAGGGACAGGATGTGCTGCTC917TTCATTGACAACATTTTCCGTTTCACTCAGGCAGGTTCTGAAGTG
Drosophila melanogaster strain Fr CG5389 gene, partial sequence.
EF388780.1:223-237
CGCGACGTGGACGGGCAGGATGTGCTGCTC223TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain Can CG5389 gene, partial sequence.
EF388781.1:271-285
CGCGACGTGGACGGGCAGGATGTGCTGCTC271TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain Id CG5389 gene, partial sequence.
EF388782.1:275-289
CGCGACGTGGACGGGCAGGATGTGCTGCTC275TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain LA20 CG5389 gene, partial sequence.
EF388783.1:214-228
CGCGACGTGGACGGGCAGGATGTGCTGCTC214TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain OK91 CG5389 gene, partial sequence.
EF388784.1:222-236
CGCGACGTGGACGGGCAGGATGTGCTGCTC222TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain ZS30 CG5389 gene, partial sequence.
EF388785.1:270-284
CGCGACGTGGACGGGCAGGATGTGCTGCTC270TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain ZS56 CG5389 gene, partial sequence.
EF388786.1:216-230
CGCGACGTGGACGGGCAGGATGTGCTGCTC216TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
Drosophila melanogaster strain ZS8 CG5389 gene, partial sequence.
EF388787.1:269-283
CGCGACGTGGACGGGCAGGATGTGCTGCTC269TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120inv/TTCATTGACAACATT
lang : en | db : ddbj120inv | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.101 | 0.094 | search_plus_done; http://172.18.8.73:27506/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.130 | 0.029 | search_minus_done; http://172.18.8.73:27506/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.130 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).