GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:43:46, GGGenome : DDBJ release 120.0, MAM division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Pteropus vampyrus clone CH279-375K22, complete sequence.
AC204458.3:16771-16785
CTCACCCAAAGGGTTGGGTAACAGGGAAAT16771TTCATTGACAACATTTGGGCAAAAGTATTTGGGGAGATGCCCTTT
Felis catus Senzu DNA, chromosome: B2, American Shorthair breed.
AP023156.1:81825232-81825246
GTTGGGGCCAGAGTTCCATCCAGAATTAAG81825232TTCATTGACAACATTCCCCTCACCACTCACTCTTTCCCAGACTTT
Ovis canadensis canadensis isolate 43U chromosome 2 sequence.
CP011887.1:195228141-195228155
TTTGTAATACATTTATCAAATAAAGGAGAA195228141TTCATTGACAACATTTACCCAAGTGAATTACAGGGTCAAAAATGC
Ovis canadensis canadensis isolate 43U chromosome 3 sequence.
CP011888.1:185504471-185504485
AAGAGAATTCCAGAAAACCATCTACTTCTC185504471TTCATTGACAACATTAAAACTTTTAGCTGTGTGGATCACAAGAAA
Ovis canadensis canadensis isolate 43U chromosome 4 sequence.
CP011889.1:7487058-7487072
TAAATGATCTGCCTTTTTTAGAGTAATCAT7487058TTCATTGACAACATTTCGAACACTTTGTAGCAAAAGAAAATAAAG
Ovis canadensis canadensis isolate 43U chromosome 4 sequence.
CP011889.1:74559753-74559767
ACTCCCCTAAATATAAGTCCCATTTCTCCT74559753TTCATTGACAACATTTCAAACAGTATATATCTTCTGTTTAAATTT
Ovis canadensis canadensis isolate 43U chromosome 6 sequence.
CP011891.1:95351025-95351039
GAATAATTAGAGATCTGAGATAACCTCTCG95351025TTCATTGACAACATTACTGTGGTTATGACAGTATTATTCTTTATA
Ovis canadensis canadensis isolate 43U chromosome 8 sequence.
CP011893.1:932378-932392
CCAGAGCTTCTGCTTCTGTCCTGAATTAGG932378TTCATTGACAACATTCCCTTCACCACCCTACTCTTTCTTATACTT
Ovis canadensis canadensis isolate 43U chromosome 23 sequence.
CP011908.1:24098996-24099010
TAGAAGTTCTTAATGTTTGTTTTCTTGGCT24098996TTCATTGACAACATTCCTTTTTGTTGTTGTGTGATCTCATCCGCT
Bos mutus isolate yakQH1 chromosome 4.
CP027072.1:7213012-7213026
TAAATGATCTGCCTTTTTTAAAGTAATCAT7213012TTCATTGACAACATTTCGAACACTTTGTAGCAAAAGAAAATAAAG
Bos mutus isolate yakQH1 chromosome 9.
CP027077.1:13850441-13850455
CCAGAGCTTCTGCTTCTATCCTGAATTAGG13850441TTCATTGACAACATTCCCTTCACCACCCTACTCTTTCTTATACTT
Bos mutus isolate yakQH1 chromosome 13.
CP027081.1:74532288-74532302
AGAAGTGTAATTACTGGGTCAGAATATGGA74532288TTCATTGACAACATTTGGGCTTGTTAAAAATTCAGGTTATTGAGT
Bos mutus isolate yakQH1 chromosome 19.
CP027087.1:22263363-22263377
CAGTGACTCCCCCTGACTCACTGCTTTAAA22263363TTCATTGACAACATTTTTTAAAAGGTAGAGAATTCTCATGAAAAG
Bos mutus isolate yakQH1 chromosome 24.
CP027092.1:23599102-23599116
TAGAAGTTCTTAATGTTTGTTTTCTTGGCT23599102TTCATTGACAACATTCCTTTTTGTGTGACCTCATCCACTACCAGC
Canis lupus familiaris breed Labrador retriever chromosome 15a.
CP050569.1:47157404-47157418
TAGAATATATTATCACTTTAAACACAGATT47157404TTCATTGACAACATTCTGTGGGCATCCATTTAATATTAATATTAA
Canis lupus familiaris breed Labrador retriever chromosome 20a.
CP050571.1:26006734-26006748
AGTCGACAACAAAAGCACTATCTGTGTTGT26006734TTCATTGACAACATTTCTGAAGTGGCCATTTATCTCTCACAGCAA
Canis lupus familiaris breed Labrador retriever chromosome 04a.
CP050572.1:18907897-18907911
AATAAATTGAAAAGGACAAAGAGAATTTCA18907897TTCATTGACAACATTTTGTAAAATTATTTTATTTATTTATTTTAC
Canis lupus familiaris breed Labrador retriever chromosome 02a.
CP050574.1:29563037-29563051
ATAATCAAAAATAACACTGCAACAGTGCAG29563037TTCATTGACAACATTTGCTTTCCAATCGTGCCAACTAAGAAAAAA
Canis lupus familiaris breed Labrador retriever chromosome 12a.
CP050578.1:36247219-36247233
ATTGAGGCCAGAGCTCCGTCCTGAATTAGG36247219TTCATTGACAACATTCCCTTACCACACTCTTTCTCAGACTTTAAG
Canis lupus familiaris breed Labrador retriever chromosome 33a.
CP050594.1:24913541-24913555
TTCTGAGAATTTAATGGAAAACATGATGAC24913541TTCATTGACAACATTGCAATGTATAATTGAAATTTGCTAAGAGAG
Canis lupus familiaris breed Labrador retriever chromosome 05a.
CP050595.1:75367501-75367515
AACTATGATTTTTTCCTTTGAAATCTATTT75367501TTCATTGACAACATTTATCCCTTATCTTCTCTCTCCAATTGTGAG
Canis lupus familiaris breed Labrador retriever chromosome 03a.
CP050599.1:17335517-17335531
CATGATCACAATCTGAGTCATGTAATTGAG17335517TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCACTGTTC
Canis lupus familiaris breed Labrador retriever chromosome 02b.
CP050613.1:29585355-29585369
ATAATCAAAAATAACACTGCAACAGTGCAG29585355TTCATTGACAACATTTGCTTTCCAATCGTGCCAACTAAGAAAAAA
Canis lupus familiaris breed Labrador retriever chromosome 12b.
CP050616.1:36256894-36256908
ATTGAGGCCAGAGCTCCGTCCTGAATTAGG36256894TTCATTGACAACATTCCCTTACCACACTCTTTCTCAGACTTTAAG
Canis lupus familiaris breed Labrador retriever chromosome 33b.
CP050619.1:24901170-24901184
TTCTGAGAATTTAATGGAAAACATGATGAC24901170TTCATTGACAACATTGCAATGTATAATTGAAATTTGCTAAGAGAG
Canis lupus familiaris breed Labrador retriever chromosome 15b.
CP050620.1:47173247-47173261
TAGAATATATTATCACTTTAAACACAGATT47173247TTCATTGACAACATTCTGTGGGCATCCATTTAATATTAATATTAA
Canis lupus familiaris breed Labrador retriever chromosome 04b.
CP050625.1:18905620-18905634
AATAAATTGAAAAGGACAAAGAGAATTTCA18905620TTCATTGACAACATTTTGTAAAATTATTTTATTTATTTATTTTAC
Canis lupus familiaris breed Labrador retriever chromosome 03b.
CP050627.1:17310945-17310959
CATGATCACAATCTGAGTCATGTAATTGAG17310945TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCACTGTTC
Canis lupus familiaris breed Labrador retriever chromosome 20b.
CP050631.1:25999722-25999736
AGTCGACAACAAAAGCACTATCTGTGTTGT25999722TTCATTGACAACATTTCTGAAGTGGCCATTTATCTCTCACAGCAA
Canis lupus familiaris breed Labrador retriever chromosome 05b.
CP050642.1:75365232-75365246
AACTATGATTTTTTCCTTTGAAATCTATTT75365232TTCATTGACAACATTTATCCCTTATCTTCTCTCTCCAATTGTGAG
Sus scrofa BAC clone CHORI242_269D21_Contig29.
FN677168.1:27486-27500
ATTAGGTAAAGCACTACTACGTAGGTCTGT27486TTCATTGACAACATTCCAGATTCTGTTGTGCTGGGCTCTCACAAT
Sarcophilus harrisii genome assembly, chromosome: 1.
LR735554.1:210081639-210081653
CATGATAACAATTTGAGTCATGTAATTGAG210081639TTCATTGACAACATTTAGATAATCCATAGCACGCTTCCACTGATC
Sarcophilus harrisii genome assembly, chromosome: 1.
LR735554.1:266868615-266868629
GTTCTATCCAAATTTACCTACTTATTACTC266868615TTCATTGACAACATTTTCTTTCCCATCTCATTGCTTTTGCACAGG
Sarcophilus harrisii genome assembly, chromosome: 1.
LR735554.1:351600817-351600831
GGAAAAACAAAGCAACTTTTCCTATGTCTC351600817TTCATTGACAACATTGTTTACTATTAAAGAATAAACAAGATCAGG
Sarcophilus harrisii genome assembly, chromosome: 1.
LR735554.1:355007507-355007521
ACATTGGCCTTCTTGTTACTCTTCATGTTT355007507TTCATTGACAACATTATATCTTCTGATTACCTGATCATATACCTG
Sarcophilus harrisii genome assembly, chromosome: 1.
LR735554.1:636049531-636049545
GTATTGTTATATAAAGTCTTCTTCTGTAGG636049531TTCATTGACAACATTTTTGTAGCAAATCTAGCAGTAGAGAAAACA
Sarcophilus harrisii genome assembly, chromosome: 2.
LR735555.1:172002722-172002736
AAAATGTCAACAAACAAAAGCCATGTACTA172002722TTCATTGACAACATTACAGTATAGACTTCCTTCTTTCTATATAGT
Sarcophilus harrisii genome assembly, chromosome: 2.
LR735555.1:329864152-329864166
TCTATCTAGTTTCTGGACTGCTTTTCAGTT329864152TTCATTGACAACATTTTCTTTTCTTTTCTTCTTTTTTTTTCTGAG
Sarcophilus harrisii genome assembly, chromosome: 2.
LR735555.1:444767350-444767364
AAGTTTGACTAGATGACTTCTGAGGTCCAT444767350TTCATTGACAACATTCTATGTTCTATGTTCTTTCATTCTGAATTC
Sarcophilus harrisii genome assembly, chromosome: 3.
LR735556.1:101681680-101681694
GATATGTTTGTATTTAGCCTGAGAAGATAG101681680TTCATTGACAACATTTGGAATTTCCCTAATCTTATATGTAAGTGA
Sarcophilus harrisii genome assembly, chromosome: 3.
LR735556.1:363283900-363283914
GTTCCATAAAGGAAGATTAATTTACTTTAC363283900TTCATTGACAACATTGGTGAAAATCTTCCTTTTCACCAGTGTTGT
Sarcophilus harrisii genome assembly, chromosome: 3.
LR735556.1:367694303-367694317
TTAATTAACTTAAAAACATGATTTTGATAG367694303TTCATTGACAACATTAGACTTACAAAGCAATCCATTGCACACAGA
Sarcophilus harrisii genome assembly, chromosome: 4.
LR735557.1:438018990-438019004
TCCTCGGTGAAGTACGACTCAGAGAAGCAC438018990TTCATTGACAACATTTACATGCCGGTGGGGCTGGCGGTCTCCTCC
Sarcophilus harrisii genome assembly, chromosome: 5.
LR735558.1:205857786-205857800
CACCAGCATCCGCATCGGATTACTAACTTT205857786TTCATTGACAACATTTTGCGGCCAGAGTTCGGCCGAAGAAAGGAA
Sarcophilus harrisii genome assembly, chromosome: 5.
LR735558.1:238363333-238363347
AAGCTACAGGGAAATGAAGAAGGCTGAAGA238363333TTCATTGACAACATTGGAAAGAGCAGTTTTAGTTGAATGTTAAGA
Sarcophilus harrisii genome assembly, chromosome: 6.
LR735559.1:45383023-45383037
TATATGCATACAAATACTTAATGAAGAATA45383023TTCATTGACAACATTTTATAGTAATTTTAAGAAGTCACATTTAAA
Lutra lutra genome assembly, chromosome: 1.
LR738403.1:197863484-197863498
AGTATGCTGCACTCCAAATACTATTGTGTT197863484TTCATTGACAACATTCACTATTACATATGCATATGAAAAACAGGC
Lutra lutra genome assembly, chromosome: 2.
LR738404.1:65154340-65154354
TAGAATATATTATCACTTTAAACACAGATT65154340TTCATTGACAACATTCTGTGGGCATCCATTTAATATTAATATTAA
Lutra lutra genome assembly, chromosome: 2.
LR738404.1:74333315-74333329
ATACATATGAAAGACATAAGGAGCATATAT74333315TTCATTGACAACATTTTACCAGGTTCATCTACTGTATTCAAATAC
Lutra lutra genome assembly, chromosome: 3.
LR738405.1:25621639-25621653
ATGGTTTTTGTTCAATTAACGTGAAGCTCT25621639TTCATTGACAACATTTCGTTCATCCTTTAAGAGCAAAATATCCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120mam/TTCATTGACAACATT
lang : en | db : ddbj120mam | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.090 | 0.083 | search_plus_done; http://172.18.8.76:27504/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.119 | 0.029 | search_minus_done; http://172.18.8.76:27504/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.119 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).