GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 10:23:46, GGGenome : DDBJ release 120.0, PAT division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Sequence 3819 from patent US 6902887.
AR674318.1:224-238
CGTGACGAGGAGGGTCAGGACGTGCTGCTC224TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 2351 from patent US 6964868.
AR767803.1:175-189
ATTGTAATAGCCAGAAATTGGAAACATATA175TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Sequence 3881 from patent US 6964868.
AR769332.1:128-142
ATTGTAATAGCCAGAAATTGGAAACATATA128TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Sequence 458 from Patent WO0123604.
AX109725.1:331-345
CGTGACGAGGAGGGTCAGGACGTGCTGCTC331TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 469 from Patent WO0123604.
AX109736.1:687-701
AGAGATGAAGAAGGTCAAGATGTCTTGCTT687TTCATTGACAACATTTTCAGATTCACCCAAGCAGGTTCCGAAGTG
Sequence 475 from Patent WO0123604.
AX109742.1:686-700
AGAGATGAAGAAGGTCAAGATGTCTTGTTG686TTCATTGACAACATTTTCAGATTCACCCAAGCTGGTTCCGAAGTG
Sequence 480 from Patent WO0123604.
AX109747.1:333-347
CGAGACGAGGAGGGTCAGGATGTCTTGTTG333TTCATTGACAACATTTTCCGATTCACCCAAGCCGGTTCCGAAGTG
Sequence 481 from Patent WO0123604.
AX109748.1:261-275
AGAGATGAGGAGGGTCAGGACGTGCTGCTC261TTCATTGACAACATTTTCCGATTCACTCAGGCCGGTTCCGAGGTG
Sequence 484 from Patent WO0123604.
AX109751.1:548-562
CGTGACGACGAGGGCCAGGATGTGCTGCTG548TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCGGAGACT
Sequence 485 from Patent WO0123604.
AX109752.1:677-691
CGTGACGACGAGGGTCAGGATGTGCTGCTC677TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGTTCGGAGACT
Sequence 487 from Patent WO0123604.
AX109754.1:321-335
CGTGACGAGGAAGGTCAGGACGTGCTTCTC321TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
Sequence 494 from Patent WO0123604.
AX109761.1:554-568
AGAGATGAGGAGGGCCAGGATGTCTTGTTG554TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCTGAGGTC
Sequence 678 from Patent WO0123604.
AX109945.1:338-352
CGTGACGAGGAAGGCCAGGATGTGTTGCTT338TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
Sequence 679 from Patent WO0123604.
AX109946.1:336-350
CGTGACGAGGAAGGCCAGGATGTGTTGCTT336TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
Sequence 768 from Patent WO0123604.
AX110035.1:556-570
CGTGATGAGGAAGGTCAAGATGTGTTGCTC556TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCTGAAGTG
Sequence 770 from Patent WO0123604.
AX110037.1:319-333
CGTGACGAGGAAGGTCAGGATGTGCTGCTC319TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 773 from Patent WO0123604.
AX110040.1:417-431
ATGCTAACAACAATGACAACAGTGCTTCTC417TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
Sequence 889 from Patent WO0123604.
AX110156.1:332-346
CGTGACGAGGAGGGTCAGGACGTGCTGCTC332TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 890 from Patent WO0123604.
AX110157.1:305-319
CGTGACGAGGAAGGTCAGGACGTGCTTCTC305TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
Sequence 892 from Patent WO0123604.
AX110159.1:320-334
CGTGACGAGGAAGGTCAGGACGTGCTTCTC320TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
Sequence 896 from Patent WO0123604.
AX110163.1:324-338
CGTGACGAGGAGGGTCAGGACGTGCTGCTC324TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 1638 from Patent WO0123604.
AX110905.1:344-358
CGTGACGAGGAGGGTCAGGACGTGCTGCTC344TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 1653 from Patent WO0123604.
AX110920.1:384-398
CGTGACGAGGAGGGCCAGGATGTGCTTCTC384TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 1654 from Patent WO0123604.
AX110921.1:403-417
AGAGACGAGGAGGGTCAGGACGTGCTGCTT403TTCATTGACAACATTTTCCGATTCACTCAGGCCGGTTCCGAGGTG
Sequence 1846 from Patent WO0123604.
AX111113.1:675-689
CGTGATGAGGAAGGHCAAGATGTGTTGCTC675TTCATTGACAACATTTTCCGTTTCACCCAAGCTGGTTCTGAAGTG
Sequence 1847 from Patent WO0123604.
AX111114.1:319-333
CGTGACGAGGAGGGTCAAGATGTGCTTCTC319TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
Sequence 2191 from Patent WO0123604.
AX111458.1:302-316
CGTGACGAGGAGGGTCAGGACGTGCTGCTC302TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Sequence 258 from Patent WO0164876.
AX269627.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Sequence 258 from Patent WO0164877.
AX271158.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Sequence 1 from Patent WO0164877.
AX282122.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Sequence 1 from Patent WO0164876.
AX282714.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 2002519000-A/2351: Novel human genes and gene expression products ii.
BD214209.1:175-189
ATTGTAATAGCCAGAAATTGGAAACATATA175TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
JP 2002519000-A/3881: Novel human genes and gene expression products ii.
BD215739.1:128-142
ATTGTAATAGCCAGAAATTGGAAACATATA128TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Sequence 60447 from Patent WO0160860.
CQ528580.1:96-110
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC96TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
Sequence 60615 from Patent WO0160860.
CQ528748.1:96-110
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC96TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
Sequence 11087 from Patent WO0171042.
CQ583329.1:988-1002
CGCGACGTGGACGGGCAGGATGTGCTGCTC988TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
JP 2004513607-A/1: HUMAN SCHIZOPHRENIA GENE.
DD021122.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 2004513607-A/220: HUMAN SCHIZOPHRENIA GENE.
DD021341.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 2004527203-A/1: HUMAN SCHIZOPHRENIA GENE.
DD062477.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 2004527203-A/220: HUMAN SCHIZOPHRENIA GENE.
DD062696.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 2006212019-A/5: A method to produce ubiquinone-10 in plant.
DD402964.1:990-1004
CGTGATGCCGAAGGTCAAGATGTGCTTTTG990TTCATTGACAACATTTTTCGTTTCACTCAGGCGAACTCTGAGGTG
KR 1020027011282-A/1: HUMAN SCHIZOPHRENIA GENE.
DI046388.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
KR 1020027011283-A/1: HUMAN SCHIZOPHRENIA GENE.
DI049443.1:103519-103533
GTATTTTTAAATTCATCGATATTTCCACTT103519TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
KR 1020027011282-A/258: HUMAN SCHIZOPHRENIA GENE.
DI051164.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
KR 1020027011283-A/258: HUMAN SCHIZOPHRENIA GENE.
DI082651.1:249-263
GTATTTTTAAATTCATCGATATTTCCACTT249TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
JP 1993137581-A/1: cDNA encoding Oryza mitochondria ATPase beta subunit.
E05034.1:990-1004
CGTGATGCCGAAGGTCAAGATGTGCTTTTG990TTCATTGACAACATTTTTCGTTTCACTCAGGCGAACTCTGAGGTG
Sequence 3819 from patent US 7186513.
EA081559.1:224-238
CGTGACGAGGAGGGTCAGGACGTGCTGCTC224TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 1766 from patent US 7309815.
EA366915.1:1048-1062
AGAGATGCTGAGGGGCAGGATGTGCTTCTC1048TTCATTGACAACATTTTCAGATTTACCCAGGCTAACTCAGAGGTG
Sequence 27655 from patent US 7314974.
EA378832.1:1133-1147
CCGTTGCTAACGCAGTCTGTAGTGTTGCTC1133TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Sequence 36200 from patent US 7314974.
EA387376.1:892-906
CGTGACGAGGAGGGTCAGGACGTGCTGCTC892TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120pat/TTCATTGACAACATT
lang : en | db : ddbj120pat | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.244 | 0.237 | search_plus_done; http://172.18.8.77:27511/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.275 | 0.032 | search_minus_done; http://172.18.8.77:27511/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.275 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).