GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:25:23, GGGenome : DDBJ release 120.0, PHG division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Aeromonas phage CF8, complete genome.
MK774614.2:51124-51138
ACACTGGGAATTGAGTTTGGGTATAATCAG51124TTCATTGACAACATTGATCTGATTATTAACTCAGCAGTAGAGCGG
Campylobacter phage vB_CcoM-IBB_35 clone Contig1, complete genome.
HM246720.1:11862-11876
GATTTAAATATTGAAGCTTATGATAGATCT11862AATGTTGTCAATGAACCAGTTTTAGAAGTATTAGTAGGATTACCA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120phg/TTCATTGACAACATT
lang : en | db : ddbj120phg | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.076 | 0.069 | search_plus_done; http://172.18.8.78:27510/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.079 | 0.003 | search_minus_done; http://172.18.8.78:27510/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.080 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).