GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:01:16, GGGenome : DDBJ release 120.0, PLN division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Pedinophyceae sp. YPF-701 chloroplast AtpB gene for ATP synthase CF1 beta subunit, partial cds.
AB561013.1:347-361
CGTGACGTAAACAAGCAAGACGTTCTTTTA347TTCATTGACAACATTTTCCGTTTCGTACAAGCGGGTTCAGAAGTA
Oryza sativa chromosome 10 clone OSJNBa0087H07, complete sequence.
AC074283.3:87092-87106
ACAAATATATTCACAATATTGATTCACAGG87092TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Oryza sativa chromosome 3 BAC OSJNBa0044H10 genomic sequence, complete sequence.
AC084405.6:75548-75562
TGATCCCAATAGTTGTTTATTTTTGGACTC75548TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
Medicago truncatula clone mth2-21k24, complete sequence.
AC121235.20:105578-105592
CTTTAACTCCCTTCAAAATATGAATCAAAC105578TTCATTGACAACATTTATTGTAGCATGTCGAAAATACATGTTTTT
Medicago truncatula clone mth2-36d22, complete sequence.
AC124217.21:23174-23188
ATTAACTTCTTTTCAAAGTCTAAGTCAAAA23174TTCATTGACAACATTTATTATAGCCTATCAAAAATACAGGCTAAC
Oryza sativa Japonica Group chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence.
AC145127.1:2261438-2261452
ACAAATATATTCACAATATTGATTCACAGG2261438TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Cicer arietinum strain FLIP84-92C clone gl1-15o9, complete sequence.
AC145456.1:41857-41871
AGGAATTATGCATTCTGCCATAAACTGCTA41857TTCATTGACAACATTTCCCACATCACTTCCTTAAATTTCCCTACA
Medicago truncatula clone mth2-15m24, complete sequence.
AC148292.9:91765-91779
ATTAACTTCTTTTCAAAGTCTAAGTCAAAA91765TTCATTGACAACATTTATTATAGCCTATCAAAAATACAGGCTAAC
Glycine max strain Williams 82 clone GM_WBb0027P13, complete sequence.
AC235233.1:154767-154781
TTGGATCAATTTTAGCCATTTATACACGAT154767TTCATTGACAACATTGTGGATGTCAAAGCTGATGGTAACTATGGA
Solanum lycopersicum chromosome 3 clone C03HBa0203H10, complete sequence.
AC238462.1:11772-11786
CATTAACCACTAGGCCACACCATTGAGCAC11772TTCATTGACAACATTTACTGATTAAAATTTAATTCAATAAAACAA
Brassica rapa subsp. pekinensis cultivar Inbred line 'Chiifu' clone KBrB022F09, complete sequence.
AC240998.1:80363-80377
CGTGATGCCGAAGGCCAAGATGTGTTGCTT80363TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCCTTTTTGTT
Solanum lycopersicum strain Heinz 1706 chromosome 10 clone hba-7g17 map 10, complete sequence.
AC244076.4:47296-47310
AGAAGTTACCTAAATTCATTTGTCATTGTC47296TTCATTGACAACATTTTGGTATATTCAAAAAATGTGGGTGAACAC
Passiflora edulis clone Pe51C2, complete sequence.
AC278225.1:9003-9017
AAGTATTTCAGAAGTAATAACTAAGATGAC9003TTCATTGACAACATTTTTATCTCAGGGGTTTACATGCCATTGGGG
Ashbya gossypii ATCC 10895 chromosome II, complete sequence.
AE016815.5:720399-720413
AGAGACGAGGAGGGTCAGGATGTGTTGCTG720399TTCATTGACAACATTTTCAGATTCACCCAAGCCGGTTCCGAAGTG
Salvinia molesta ATP synthase beta chain (atpB) gene, partial cds; chloroplast gene for chloroplast product.
AF313552.1:512-526
CGAGATGTCAACAAGCAAGACGTACTCCTA512TTCATTGACAACATTTTTCGTTTCGTCCAAGCGGGATCAGAAGTC
Arabidopsis thaliana mRNA for mitochondrial F1 ATP synthase beta subunit (p_beta gene).
AJ271468.1:1572-1586
CGTGATGCTGAAGGCCAAGACGTTTTGCTT1572TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Oryza sativa Japonica Group cDNA clone:001-037-A03, full insert sequence.
AK061681.1:1029-1043
CGTGATGCCGAAGGACAAGATGTGCTTTTG1029TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Oryza sativa Japonica Group cDNA clone:002-127-D01, full insert sequence.
AK107392.1:1246-1260
GCTCTCTGATCAACACTCTTTTTCGGAACA1246TTCATTGACAACATTCGTCGAGCTGGACTCGACCATGGATTATGG
Oryza sativa Japonica Group cDNA clone:002-153-G05, full insert sequence.
AK108995.1:907-921
CGTGACCAGGAGGGACAGGATGTCTTGCTC907TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Arabidopsis thaliana At5g08670 mRNA for putative H+-transporting ATP synthase beta chain (mitochondrial), complete cds, clone: RAFL19-76-L24.
AK118538.1:1017-1031
CGTGATGCTGAAGGCCAAGACGTTTTGCTT1017TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana At5g08690 mRNA for putative H+-transporting ATP synthase beta chain (mitochondrial), complete cds, clone: RAFL19-82-J07.
AK118582.1:1017-1031
CGTGATGCTGAAGGCCAAGATGTCTTGCTT1017TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv1027K09.
AK355900.1:1834-1848
TTTGGCTCAGGTTTACCCTCTTGCCTATTT1834TTCATTGACAACATTTGTCAGTATATCGCTTCTAATTTTACTCAG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv2010F24.
AK362825.1:829-843
AGAGATGAGGAGGGTAAGGACGTGCTGCTT829TTCATTGACAACATTTTCCGCTTCACCCAAGCTTGCTCAGAGGTG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv3077J11.
AK374834.1:952-966
CGTGACGAGGAGGGTCAGGATGTGCTTCTC952TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Arabidopsis thaliana DNA chromosome 5, BAC clone T2K12 (ESSA project).
AL590346.1:28840-28854
CGTGATGCTGAAGGCCAAGATGTCTTGCTT28840TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Azolla pinnata chloroplast partial atpB gene for putative beta subunit of chloroplast ATP synthase, specimen voucher Schneider s.n. (GOET).
AM176622.1:512-526
CGAGATGTCAACAAGCAAGATGTACTTCCA512TTCATTGACAACATTTTTCGGTTCGTCCAAGCGGGATCAGAAGTC
Salvinia oblongifolia chloroplast partial atpB gene for putative beta subunit of chloroplast ATP synthase, specimen voucher Unknown.
AM176624.1:477-491
CGAGATGTCAACAAGCAAGACGTACTTCTA477TTCATTGACAACATTTTTCGTTTCGTCCAAGCGGGATCAGAAGTC
Vitis vinifera, whole genome shotgun sequence, contig VV78X040248.2, clone ENTAV 115.
AM460727.1:42408-42422
AACAACCAAACAGGTCCTAAACCTCTCACT42408TTCATTGACAACATTATATCCTCAGGTCTTATTCTCTACCATTGT
Vitis vinifera contig VV78X024264.3, whole genome shotgun sequence.
AM482307.1:596-610
TCTTTAAATGGAACAAAATACTATATTCAT596TTCATTGACAACATTATCTTAATGTATTCGGATGATAGGGAAGAC
Oryza sativa Japonica Group genomic DNA, chromosome 7, PAC clone:P0453E05.
AP004275.3:32147-32161
AGATCTATCTAATTTAGGTGTAGTGCTCTC32147TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
Oryza sativa Japonica Group genomic DNA, chromosome 7, PAC clone:P0492E07.
AP004305.3:26834-26848
CGTGTGCCTCCTGGATGCACCAATCGGCTG26834TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
Oryza sativa Japonica Group genomic DNA, chromosome 9, PAC clone:P0556H01.
AP005424.3:30622-30636
CTTTCAAATGATGGTCAAACTAATTATAAA30622TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Oryza sativa Japonica Group genomic DNA, chromosome 9, BAC clone:OJ1328_D07.
AP005833.2:126234-126248
CTTTCAAATGATGGTCAAACTAATTATAAA126234TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Aspergillus oryzae RIB40 DNA, SC010.
AP007175.1:1292143-1292157
CGTGACGAGGAAGGTCAGGATGTGCTGCTC1292143TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Oryza sativa Japonica Group DNA, chromosome 3, cultivar: Nipponbare, complete sequence.
AP014959.1:9682664-9682678
TGATCCCAATAGTTGTTTATTTTTGGACTC9682664TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
Oryza sativa Japonica Group DNA, chromosome 7, cultivar: Nipponbare, complete sequence.
AP014963.1:12705943-12705957
CGTGTGCCTCCTGGATGCACCAATCGGCTG12705943TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
Oryza sativa Japonica Group DNA, chromosome 7, cultivar: Nipponbare, complete sequence.
AP014963.1:24274176-24274190
AGATCTATCTAATTTAGGTGTAGTGCTCTC24274176TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
Oryza sativa Japonica Group DNA, chromosome 9, cultivar: Nipponbare, complete sequence.
AP014965.1:16180672-16180686
CTTTCAAATGATGGTCAAACTAATTATAAA16180672TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Oryza sativa Japonica Group DNA, chromosome 10, cultivar: Nipponbare, complete sequence.
AP014966.1:2282429-2282443
ACAAATATATTCACAATATTGATTCACAGG2282429TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Vigna angularis var. angularis DNA, chromosome 2, almost complete sequence, cultivar: Shumari.
AP015035.1:2763351-2763365
GTGTATCAATTAAATCTATTCCGTCAATTT2763351TTCATTGACAACATTAATTGTGTGGTTATGTAGCAAAAGAGTGTA
Vigna angularis var. angularis DNA, chromosome 4, almost complete sequence, cultivar: Shumari.
AP015037.1:17743347-17743361
TCCTCAAGTTGGAAGTTCTTACGCGTATTT17743347TTCATTGACAACATTATTTACTAGAGGTCCTTCACCATTTAGTGT
Vigna angularis var. angularis DNA, chromosome 8, almost complete sequence, cultivar: Shumari.
AP015041.1:3253525-3253539
TATATTTAGGTTTGCAGAATTATAGATGAA3253525TTCATTGACAACATTTGCAATGTTGGTGACCACTTGCTTACTTTG
Prunus dulcis DNA, pseudomolecule Pd03.
AP019299.1:15714560-15714574
GGGTTTTGATGCCAAGCCACGTGTGAGGCT15714560TTCATTGACAACATTTTCTTGCATTAAAAAATTCTAAGGGGACAA
Prunus dulcis DNA, pseudomolecule Pd04.
AP019300.1:4537392-4537406
AATATAGTAGATGAAGGTTGAATCTGGATT4537392TTCATTGACAACATTCAGAAAGGGGTGTATTTGAATAAAAAAGTT
Prunus dulcis DNA, pseudomolecule Pd04.
AP019300.1:6238962-6238976
ATAAGTTTTCTCTGTTCGGTTTAATTATTT6238962TTCATTGACAACATTGGATCATGTTAGAATTTCAAGATAAACAGA
Prunus dulcis DNA, pseudomolecule Pd07.
AP019303.1:11626678-11626692
AACAAACAATTTTAGTAAGTGAAATCTTAA11626678TTCATTGACAACATTCTACAGGAATTTATTAATCTATCTTTCCAG
Marchantia polymorpha subsp. ruderalis Tak-1 DNA, chromosome: 1.
AP019866.1:22155075-22155089
CAAAAAACTATGAATAATTCCATTGATTAT22155075TTCATTGACAACATTGGAGTGATTAGATCACTCAATATAGAATTC
Prunus dulcis DNA, unplaced-scaffold_283.
AP020620.1:8084-8098
GAAGTTTCCCTCTGTTCGGTTTAATTATTT8084TTCATTGACAACATTGGATCATGGTTCCAATTTCAAGAGAAACAA
Lotus japonicus B-129 DNA, chromosome 1, complete sequence.
AP022629.1:45918300-45918314
TTTATAATAGAAGTTTCCTTGAAAAATTTA45918300TTCATTGACAACATTCTTAATTACAGGAGAAACTTGGCTCTATAT
Lotus japonicus B-129 DNA, chromosome 2, complete sequence.
AP022630.1:11714130-11714144
AGACTATTCTTGGACAAGTTCGTGGTGGTG11714130TTCATTGACAACATTCTGATTTACTCGAAGAGAAAAGAGGAACAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120pln/TTCATTGACAACATT
lang : en | db : ddbj120pln | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.097 | 0.090 | search_plus_done; http://172.18.8.78:27507/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.126 | 0.029 | search_minus_done; http://172.18.8.78:27507/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.126 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).