GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:49:18, GGGenome : DDBJ release 120.0, ROD division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Rattus norvegicus Mcs BAC CH230-1A1 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence.
AC091242.12:72597-72611
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT72597TTCATTGACAACATTAAATATTTACTGAATCTTAAATCTTATCCT
Rattus norvegicus Mcs1 CH230-3I8 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence.
AC094490.9:77809-77823
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT77809TTCATTGACAACATTAAATATTTACTGAATCTTAAATCTTATCCT
Mus musculus chromosome 3, clone RP23-341B15, complete sequence.
AC102806.18:103943-103957
ATTGCAAACCTTAACTTACAGGGATGTTTA103943TTCATTGACAACATTTTACTTATTTTTCATTTCTCTGATGTTTAA
Mus musculus chromosome 3, clone RP23-49O22, complete sequence.
AC107701.8:76582-76596
TAGATTCTGCCTCAGAACTTGTAGTTGAAG76582TTCATTGACAACATTGGTCAACATGCAGCTTGAATCTGGGGCAAC
Mus musculus chromosome 5, clone RP23-330E5, complete sequence.
AC118200.8:51451-51465
TAGAATCAGTGTAAGCCATCCCTACACTTA51451TTCATTGACAACATTCATGCAATCTTCAGTGTTCATTACTTTGCT
Mus musculus BAC clone RP23-109J14 from 1, complete sequence.
AC125216.3:133794-133808
GAATACTTAATGTACCATTTGGAAACACTG133794TTCATTGACAACATTTTATTTGCTATTTCCTGCTGTCTTTAAAAA
Rattus norvegicus CH230-12L9 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence.
AC132498.4:110866-110880
CCTCTCCCATTTACATTTAGTTTTAAGTAA110866TTCATTGACAACATTTTTTGCATTGTTCAGCCCTTTACCTGTATT
Mus musculus BAC clone RP24-159A20 from chromosome 5, complete sequence.
AC152165.2:163547-163561
GTCAACATGTACTTTAAACTTTAGTAATGT163547TTCATTGACAACATTGATGCTTTTGGCTTGGGGGCATGGATGCTA
Mus musculus 6 BAC RP23-387H1 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence.
AC158660.4:195953-195967
AAAGTACTATCAGTTTCCTAAATATATCCA195953TTCATTGACAACATTGTTCACTCTTCCATAAACATCTGCTGGTTA
Mouse DNA sequence from clone RP23-307O24 on chromosome 2.
AL831781.8:102647-102661
AGACAAATTAAGACTGTATTGTATCATGGT102647TTCATTGACAACATTTAAAATTGTTACATATTTCAAAATTTTTTA
Mouse DNA sequence from clone CH29-502J5 on chromosome 6.
CU207317.13:16788-16802
TGAACACATTCTCCCTGTTTGTGTCATCAC16788TTCATTGACAACATTTAACTGGGCCTTCTGTGTGGATACCATGAT
Sciurus carolinensis genome assembly, chromosome: 1.
LR738590.1:65607828-65607842
ATTACACTGCCTGTTCGTCTTCTTTTGCAT65607828TTCATTGACAACATTTCATTGTAAGCCTTTCTAGTCCTAAGTTTT
Sciurus carolinensis genome assembly, chromosome: 2.
LR738591.1:107693935-107693949
CGGGCAGGAAAAGAGCCATCCAGGAGGTGC107693935TTCATTGACAACATTTTGGGAGGAACAGTTCCCTTTAGGCAGATG
Sciurus carolinensis genome assembly, chromosome: 3.
LR738592.1:128834629-128834643
AACTAGTGAATTGATAATGCTGATTTTTTT128834629TTCATTGACAACATTATAAAATATAGAAGATAAATAAGTACTTTT
Sciurus carolinensis genome assembly, chromosome: 4.
LR738593.1:71137194-71137208
GTGATTTATTCATTCTGATTTGAATTTTCA71137194TTCATTGACAACATTTCTTAGAAAGGGGGCACATACCAGTAGGAA
Sciurus carolinensis genome assembly, chromosome: 4.
LR738593.1:134650461-134650475
TGGATAATCTCTAGGCTCATTAGGAAGATG134650461TTCATTGACAACATTCTAGGAATTGCTGATCTAAATCATCTTTGC
Sciurus carolinensis genome assembly, chromosome: 4.
LR738593.1:135868885-135868899
CTGAGCTCACACCAAGGTCCTATGATGAGC135868885TTCATTGACAACATTCTAAGGCTTCTCTAGCCTATGTCTCCAAAG
Sciurus carolinensis genome assembly, chromosome: 5.
LR738594.1:39341201-39341215
AAATTATGAAATCTAACATAAAAATCATCA39341201TTCATTGACAACATTAATAGTTAATAAATGTAGAAAATTTTACTC
Sciurus carolinensis genome assembly, chromosome: 6.
LR738595.1:80796469-80796483
GAATCAAAGGTCAAAATTTAAAGAAATGAT80796469TTCATTGACAACATTAAATATTTACTGAATCTCAACTTTTTCCTG
Sciurus carolinensis genome assembly, chromosome: 8.
LR738597.1:35470775-35470789
CTCTTTACCTTATAAGAATGTAGCCTCTTT35470775TTCATTGACAACATTTTTACTTAAATGGCAGAAAGATCAAGAGGG
Sciurus carolinensis genome assembly, chromosome: 9.
LR738598.1:17116716-17116730
CCATTTATATTAATTTCTAAGCTTATTTTA17116716TTCATTGACAACATTTAAGTTACTGTAGGACTTAGAGTGCAGTAC
Sciurus carolinensis genome assembly, chromosome: 9.
LR738598.1:112299787-112299801
CTCTCTAATGGTCAACATAACATATTCAAT112299787TTCATTGACAACATTCATTATGGGCCATTAATTTTATTCTATAAT
Sciurus carolinensis genome assembly, chromosome: 10.
LR738599.1:123787557-123787571
GATGATAATATATTTACTTGATACCATATA123787557TTCATTGACAACATTCTTCTGTTATTTTTGGTTCGGAGAATACTT
Sciurus carolinensis genome assembly, chromosome: 11.
LR738600.1:60700667-60700681
TAGAATGTAATGTAACTGAAAGAAAAAGTT60700667TTCATTGACAACATTTATTGTTAATGTGCAGTTTATTTTTACTTT
Sciurus carolinensis genome assembly, chromosome: 14.
LR738604.1:62976319-62976333
GTTAAAATTTTAAAATGGGATATATTTAAT62976319TTCATTGACAACATTAAAAAAAATTCTATTTTCAATGGCTTTGGT
Sciurus carolinensis genome assembly, chromosome: 17.
LR738607.1:52110747-52110761
AGTATGCTGCACTCCAAATACCATTGTGTT52110747TTCATTGACAACATTCACTGTTACATATGCATATGAAAAACAGGC
Sciurus vulgaris genome assembly, chromosome: 1.
LR738611.1:198320633-198320647
TTCATTCAGTTGGTTAACACCTGAAGCACC198320633TTCATTGACAACATTGATATCCTAAGCTAGCCCTTGAAAGGCCAA
Sciurus vulgaris genome assembly, chromosome: 2.
LR738612.1:97198699-97198713
GATCTAATCAGTGAAACTTAAACTCACTGG97198699TTCATTGACAACATTAAAAGATTAATGTTAATGTTAAATGTAATA
Sciurus vulgaris genome assembly, chromosome: 5.
LR738615.1:137797406-137797420
TGGATCATTTCTAGGCTCATTAGGAAGATG137797406TTCATTGACAACATTCTAGGATTTGCTGAACTAAATCATCTTTGC
Sciurus vulgaris genome assembly, chromosome: 5.
LR738615.1:139109071-139109085
CTGAGCTCACACCAAGGTCCTATGATAAGC139109071TTCATTGACAACATTCTAAGACCTCTCTAGCCTGTGTCTCCAAAG
Sciurus vulgaris genome assembly, chromosome: 6.
LR738616.1:83507239-83507253
CATGATAACAATCTGAGTCATGTAGTTGAG83507239TTCATTGACAACATTTAAATAATCCATAGCTCTTTTCCACTGTTC
Sciurus vulgaris genome assembly, chromosome: 8.
LR738618.1:35938805-35938819
TCTTTACCTTATAAGAATGTAGCCTTTTTT35938805TTCATTGACAACATTTTTACTTAAATGGCAGAAAGATCAAGAGGG
Sciurus vulgaris genome assembly, chromosome: 9.
LR738619.1:84979856-84979870
AGTTTTCCCAATGAGCCAATAAGCTGTAGA84979856TTCATTGACAACATTAGCTGTGCTTATAAGCTCAATCTCTCTTTC
Sciurus vulgaris genome assembly, chromosome: 10.
LR738620.1:9263039-9263053
GGGAGCAAGACAAGGACAAGCTTGAGTATA9263039TTCATTGACAACATTGAAGCCTACAATACGACCCTCCTCACAAAG
Sciurus vulgaris genome assembly, chromosome: X.
LR738621.1:50873969-50873983
ACTTTCTTTAAGTATTTCACATATTTCAAA50873969TTCATTGACAACATTAATTTTAAGATCAGTTTTCCCATTTCTACA
Sciurus vulgaris genome assembly, chromosome: 11.
LR738622.1:56140488-56140502
TAGAATGTGATGTAACTGAAAGAAAAAGTT56140488TTCATTGACAACATTTATTGTTAATGGGCAGTTTATTTTTACTTT
Sciurus vulgaris genome assembly, chromosome: 16.
LR738627.1:48603204-48603218
AGTATGCTGCACTCCAAATACCATTGTGTT48603204TTCATTGACAACATTCATTATTACATATGCATATGAAAAACAGGC
Mus musculus chromosome 10, clone RP23-179O14, complete sequence.
AC118198.7:210723-210737
TACAGAGATACAGGATGGTTACATATATGA210723AATGTTGTCAATGAAGTCCATCATATAAACAAACAGAAAGAAATA
Rattus norvegicus BAC CH230-273M4 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence.
AC120565.6:21441-21455
AATACAGGTAAAGGGCTGAACAATGCAAAA21441AATGTTGTCAATGAATTACTTAAAACTAAATGTAAATGGGAGAGG
Mus musculus 6 BAC RP23-265B8 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence.
AC153574.4:84477-84491
ATCATGGTATCCACACAGAAGGCCCAGTTA84477AATGTTGTCAATGAAGTGATGACACAAACAGGGAGAATGTGTTCA
Mus musculus 10 BAC RP23-116E8 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence.
AC153829.7:152005-152019
TACAGAGATACAGGATGGTTACATATATGA152005AATGTTGTCAATGAAGTCCATCATATAAACAAACAGAAAGAAATA
Mus musculus BAC clone RP23-399K3 from chromosome 14, complete sequence.
AC154574.2:107188-107202
TGGCTGCTGAGGTTGTCACTCTCAGTGGGC107188AATGTTGTCAATGAACACACCCTCCAGGGAGAGATTCCAGCAGCA
Mus musculus 6 BAC RP24-532I24 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence.
AC155835.3:114834-114848
TAACCAGCAGATGTTTATGGAAGAGTGAAC114834AATGTTGTCAATGAATGGATATATTTAGGAAACTGATAGTACTTT
Ictidomys tridecemlineatus clone VMRC20-719B8, complete sequence.
AC184040.3:67141-67155
CTTTTTTGTTTTATCTGCCATTTAAGTAAA67141AATGTTGTCAATGAATAAACAGTTACATTCTTTATAGGTTAAAGA
Mouse DNA sequence from clone RP23-211J18 on chromosome 2.
AL844531.6:20586-20600
ATATCTATTTATTCATTGATGTAGCTTTCA20586AATGTTGTCAATGAACACTGTTACTTCGTTGAGCACATGAAAAGT
Sciurus carolinensis genome assembly, chromosome: 2.
LR738591.1:104660492-104660506
TATTACATTTAACATTAACATTAATTTTTT104660492AATGTTGTCAATGAACCAGTGAGTTTAAGTTTCACTGATTAGATC
Sciurus carolinensis genome assembly, chromosome: 2.
LR738591.1:113570536-113570550
ATTCCAAAATAGAAAAGTGTACAGATCATA113570536AATGTTGTCAATGAATTATCACAAACTGAACACAACTTTGTAATT
Sciurus carolinensis genome assembly, chromosome: 6.
LR738595.1:86923588-86923602
GAACAGTGGAAAAGAGCTATGGATTATTTA86923588AATGTTGTCAATGAACTCAACTACATGACTCAGATTGTTATCATG
Sciurus carolinensis genome assembly, chromosome: 7.
LR738596.1:86319871-86319885
GTCTGGGAAAGAGTGGGGTGGCGTGAAGGG86319871AATGTTGTCAATGAACCTAATTCAGGACAGGAGCTCTGGCCCTAA
Sciurus carolinensis genome assembly, chromosome: 8.
LR738597.1:61647843-61647857
TATGTGATTTTGCTACGTAAAATTTTCATA61647843AATGTTGTCAATGAATGAAGTTAGTTCAACATTGTGGACAGTCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120rod/TTCATTGACAACATT
lang : en | db : ddbj120rod | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.094 | 0.087 | search_plus_done; http://172.18.8.72:27503/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.121 | 0.027 | search_minus_done; http://172.18.8.72:27503/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=13
0.128 | 0.007 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).