GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2019-04-23 15:30:25, GGGenome : Kangaroo rat genome, Broad/dipOrd1 (Jul, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_122256:5280-5294
TTCCTCATGCATTAAAATATATCTTTGGAT5280TTCATTGACAACATTTTGAGGCAGTTATGATCATTTTGGCTCTTC
scaffold_1652:50675-50689
TTATTCCACTTTACATGCTAATCTTACTTT50675TTCATTGACAACATTTTACTCCAAAAATAGTAAATTTAGAAATCA
scaffold_20072:25226-25240
TTTAGGAAGGGTGGATTTTACTGTTGCATT25226TTCATTGACAACATTCTAACCACCCCCATCTTATTAGTTGTGATT
scaffold_20072:27541-27555
TTTAGGAAGGGTGGATTTTACTGTTGCATT27541TTCATTGACAACATTCTAACCACCCCCATCTTATTAGTTGTGATT
scaffold_2840:88341-88355
AGCTGCCAGACACTATACAGGGTAAAATTT88341TTCATTGACAACATTTCAAAGATCATTGTGCAATGCTTTAGTCCT
scaffold_5423:43703-43717
ATTTGTAGTTCTTCCTTGTAGCTAACATAA43703TTCATTGACAACATTTGTATATGTCTTCATACTACCCACTCGCAG
scaffold_5875:49141-49155
ATCATCAGGGTGAAGTTGGCCAGTTGTGGC49141TTCATTGACAACATTGTTCTAGCCAGGAAGTTTTTCACACTCTAC
scaffold_20113:2752-2766
AACTCAAGTCTCATCTCCAGCTTCACATCA2752AATGTTGTCAATGAATTTTTTTATTAGAAATTTTCATTATAAACT
scaffold_3808:11907-11921
TTGAATATACATTCTAACCTCATCTTAACA11907AATGTTGTCAATGAAAAACCTGAATAACAGTAGTACTGGTTGCTG
scaffold_43907:1060-1074
GCCTGCTTTTCATATGCATATGTAATAGTG1060AATGTTGTCAATGAAAACACAATAATATTTGGAGTGCAGTATGCT
scaffold_85:205308-205322
TGCCTGCAAACCTCATCCACTTTTATCCAA205308AATGTTGTCAATGAACATACACTTGTTTATGACATCATTTTTCTA
scaffold_9004:38267-38281
CATAACAATGGCAACTAAGTTGTGTGCATG38267AATGTTGTCAATGAAATGAAGAAGAATCAACAACATGCATAGTAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/dipOrd1/TTCATTGACAACATT
lang : en | db : dipOrd1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.106 | 0.100 | search_plus_done; http://172.18.8.78:28039/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.115 | 0.010 | search_minus_done; http://172.18.8.78:28039/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.119 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).