GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-01-18 19:43:18, GGGenome : D. melanogaster genome, BDGP Release 6 + ISO1 MT/dm6 (Aug, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr3L:16099164-16099178
CGCGACGTGGACGGGCAGGATGTGCTGCTC16099164TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAGGTG
chr3R:30995778-30995792
TGTTGCGGTGCGCGTACGTGGCGTATACGC30995778AATGTTGTCAATGAACCTGCACGGATTATTGGCATTAAGTAAGCC
chrX:1147120-1147134
CTCTTTAAAATCCCATTAATCCTCTTATTA1147120AATGTTGTCAATGAACGGCTCTTTAGGCTTGATAGATTATTTAAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/dm6/TTCATTGACAACATT
lang : en | db : dm6 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.103 | 0.096 | search_plus_done; http://172.18.8.76:28098/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.112 | 0.010 | search_minus_done; http://172.18.8.76:28098/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.113 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).