GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:46:39, GGGenome : Gorilla genome, GMSRT3/gorGor5 (Mar, 2016)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

CYUI01000001v1:23692037-23692051
TGACAGTATAGTTATATGAGAAGCAACTTC23692037TTCATTGACAACATTGTCATCACCCTTAATGAAATGTGGGGCATT
CYUI01014901v1:23910091-23910105
ATTGCAGCAAAGAAGCACATTTATATTCTA23910091TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
CYUI01014902v1:4890514-4890528
CTTTTAATGTGAATATTAAACTTTATCAAA4890514TTCATTGACAACATTTTTAAACTTCTGGAACAAACCTATCTCATG
CYUI01014916v1:810317-810331
TTTACTTTCAAAAGGTGGGGAGGGGAAGAA810317TTCATTGACAACATTTAGAAATCAGGAGATTTCATGTGGAAAAAA
CYUI01014916v1:5211050-5211064
ATTGTAATAGCCAGAAATTGGAAACATATA5211050TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
CYUI01014918v1:16763509-16763523
AGAAACCTCTGATTTTGTGTAACACTTCTT16763509TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
CYUI01015020v1:8708630-8708644
TTGATTTTGTATATATTAAATAGTTGAAAC8708630TTCATTGACAACATTAAATTTGTTTTCTAGGCTCTATTGGGGTAA
CYUI01015217v1:4200618-4200632
CCTGGGTATAATGCACTGACCTGCTGATCT4200618TTCATTGACAACATTGCCATCGACTTTGGAGCTGGAAAGGCCCTC
CYUI01015358v1:2221106-2221120
GTGGTGCCTGGCCTGAGTCAGCACGTTAGC2221106TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
CYUI01015445v1:1140385-1140399
CTATTTCAATCAACCATCTTGTAATCATAC1140385TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
CYUI01000005v1:24585866-24585880
TGCTAGGAATGATAAGGTGTGGCTGATGGT24585866AATGTTGTCAATGAATTATCAGGCTTTCCTCAAACGCCTTTCGTT
CYUI01000064v1:202462-202476
GCCTGTTTTTCATATGCATATGTAATAGGG202462AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
CYUI01000212v1:23149-23163
CTCCCTTAGGAGAGCTGTTAGCATTATACT23149AATGTTGTCAATGAAAAAGCTAAGATAGGCCAGGCATGGTGGCTC
CYUI01014913v1:12738257-12738271
TAATTTTTGTTGAGACAAATCTCCCAAGTA12738257AATGTTGTCAATGAAATGATATGAAATATATACATATATAAATAT
CYUI01014938v1:16257964-16257978
TTAATATTAATATTAAATGGGTGCCCACAA16257964AATGTTGTCAATGAAAATCTGTGTTTAAAGCGATAATATATTCTG
CYUI01014963v1:6685364-6685378
ACTCACTGGATCCAATCAGCATAATGTCAT6685364AATGTTGTCAATGAAAAGAGTTGAACTCTGTAAAATATTTGAAGA
CYUI01015012v1:12110652-12110666
TTTGAAAAAAGAGACACAATAAAACTTAAT12110652AATGTTGTCAATGAAAAGTGGAAATATCGATGAATTAAAAAATAT
CYUI01015086v1:1341410-1341424
AATTCTATTTAATTTCTGCAGAACTTAATG1341410AATGTTGTCAATGAAAGAATATGAAGACTGATTTGGGGGTCCAAA
CYUI01015169v1:2019996-2020010
AACTAACACCCATAAAAGGTATGACTCTTT2019996AATGTTGTCAATGAAGATTTAACATAATATTCTACAACAAATATA
CYUI01015286v1:798822-798836
GTTGTCACCTCAGTGTGAGTTACCTCAGGC798822AATGTTGTCAATGAATACAGCCTCCAGGGAGAACCTCCAGACTGC
CYUI01015353v1:1124339-1124353
CTTTGCTCTATTCACTGTCCTCAATGCTAG1124339AATGTTGTCAATGAACAAGACATATCTATGTTCCAGGAAACTCAA
CYUI01015385v1:4009091-4009105
CCTGCAATTGGCCATCTAGTGTGACAAGGC4009091AATGTTGTCAATGAAATGTGGGTATAATCTAGCTTGTCTCACTTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/gorGor5/TTCATTGACAACATT
lang : en | db : gorGor5 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.071 | search_plus_done; http://172.18.8.78:28762/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.006 | search_minus_done; http://172.18.8.78:28762/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=40
0.086 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).