GGGenome Help | Japanese

Max number of mismatches/gaps: (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2019-01-16 13:37:52, GGGenome : Human genome, GRCh37/hg19 (Feb, 2009)



Matches are highlighted with blue background. Mismatches and indels are marked in red.


Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI :
lang : en | db : hg19 | k : 2 | strand : | query_string : TTCACTGACAACATTGAGTA | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.467 | 0.461 | search_plus_done;
1.393 | 0.926 | search_minus_done;
1.410 | 0.017 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).