GGGenome Help | Japanese


Max number of mismatches/gaps: (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2018-11-13 08:13:54, GGGenome : Human genome, GRCh37/hg19 (Feb, 2009)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1:77930953-77930971
AGCAGTACTCAAGATCACCTTTTTTTAAAG77930953TTCACTG-CAACATTCAGTAGATGAAAAATGTGTAGCTGTAATTCATTGA
chr1:106947513-106947532
TAGAAAACATACCACATAAAGAAGCAATCT106947513TTCACTGCACAA-ATTGAGTATAAAATTTAACCCGTTTGAAAGGGTCATTA
chr2:30898313-30898332
GCCCCCAGCCACTTATATGTATTTTTTAAA30898313TTCACTGACAACATTGAGTAGAAAAGATAATTTTTTTTTTTTTGAGACAG
chr2:141517099-141517117
TTTATTTTCTTTAACACAGCCTTTGATAAA141517099TTCACTGAC-ACATTGAGTTAGCCATAGTGTGTAATGGGAGACTGCCCAG
chr2:163535086-163535106
TGAGAAAGAGGACACCCTAAGAATTATGGC163535086TTCACTGACAACATTAGAGAACATATCAAACTCAAACGAATATTCTGGGGT
chr2:186291305-186291324
ATTATGAACAGAAAAAAAGCAAAGGTTACT186291305TTCACTGAGCAACATTGAG-ATAGAGTTTCTTTTGGACACTTAATTTTGTA
chr2:206339508-206339526
GTAATGCAGAAAATAGCTAATTTCACCCCA206339508TTC-CTGACAACTTTGAGTATCATCACTTTCCTTCCTTTACCCTTTACTA
chr2:235498941-235498960
GGAGCACAGCTGCAGTTGAACTCAGTTGGT235498941TTCACTGAC-ACATTGCAGTAGGCAGAAGAATCATGGGCACGTAGGTAAGA
chr3:7763221-7763239
CACTTGATCAGTGCAGACATAGATCAATTC7763221TTCACTG-CAAAATTGAGTAGTGAATAAATAAACTTACTTCAGCTAACCT
chr3:107912698-107912716
ATATGTTTGGAAGAACTAGGCATATGCACA107912698TTCACTGGC-ACATTGAGTACCTGTCTTAGACTCTACGAGACCCAGCTTC
chr3:119451773-119451792
GTTCAAAAGAGGCTTATTTAGTTATTTAAT119451773TTCACTGACAA-ATTGAAGTATCACATGGCCAAGATCATGAGTTGCTGGTT
chr3:176282654-176282673
TCAGAATAAAAAAAATGATTATGTATGATT176282654TTCACTGACCATATTGAGTATAGGAATGGTAACACTGTGTTAGTTACATG
chr4:127134996-127135015
CTTTTTGTGAAATAGGAATTTAAAGTCAAT127134996TTCACTGAGAACATTGAGGACTTTTTTTTTGCCTTTTAAGAGTCATGCTC
chr4:128011907-128011924
CTCCCACACAATAATGGGAGAGTTTAACCC128011907TTCACTGACAACATT-AG-ACAGATCATCAAGACAGAAAATCAACAAAGA
chr5:59044793-59044811
TCCCAGATACAGCTTCAGATGACTATAGCC59044793TTCACTGACAAC-TTGAGTGCAATTTCTTCTAGGAACTTTAGTCAGAACC
chr5:86132917-86132934
ACTAGAGTTGGAAAGAATTTTATTTTTATT86132917TTCACTGA-AA-ATTGAGTAAAAAATGTGAATATAAATGCTATTATGTGA
chr6:22543169-22543188
TGTGGCATACATTTATTTTTGAATAAATTG22543169TTCACTGGCAACATTGAGTTTAAGAAGAAGGGTGAAAAATTACTTGGAGA
chr6:82260243-82260261
TATGAGACAGGAAGAAATTAAATTTTATTA82260243TTCACTGACAACA-TGATTATGTATGTAGAAAACGCTATGTAATCTAAAA
chr6:95214803-95214821
ACCTTTAACTTTAAACTTTTTTTTTAAGAT95214803TTCACTTA-AACATTGAGTATGAATATAAAAGGAGGGAAAAAAAAACACA
chr6:105109672-105109690
CACCACAATAATATTGGTGGACCTCAATAC105109672TTCACTGACAACATTGAG-AGGTCATCAAAACAGAAAGTCAACAAAGAAA
chr6:151088192-151088209
AAAGTCTTAAGCTGCTATTAAATACAGACA151088192TTCACTG-C-ACATTGAGTATTAGTCCATCCTTTTGGACCATGTGTAATT
chr7:8118614-8118632
AAAGAGGAAATGCTAAATTTTATCTAATGT8118614TGCACTGACAACATTGA-TAGCATTTTGCTTTGCCTTCTCTTTTGAACAT
chr7:41689138-41689156
AAACTCAGGCCTTTACTGTATGCTAGAAGG41689138TTCACTGACAAC-TTTAGTACATTTTAAAGTCCTGTAACTCCGCCTTAAC
chr8:90913784-90913803
ACTCTAAAATACCTGCTCATCACAAGTTTG90913784TTCAGTGACAACATTCAGTAAAACTTAACATTTGTTTTACAAAATTATGT
chr8:93876075-93876095
TTGAAACTTCAGGAAATCCCACCCCACCAT93876075TTCACTGGACAACATTGAGTCATATGCCCACATTCAAGCCAATTACCAGAA
chr11:22831617-22831635
AGGTCCTGCTGCTCACTGCATAGAACGCCA22831617GTCACTGA-AACATTGAGTATTTCCAGGGGAAAAAGCTTTATTCGGGTGC
chr11:92192201-92192219
TGATTATATTTCTCCATATCAAAAAAGGCA92192201TTCACTGACAACTTTGAG-ATGCAGTTATGATCCTTTACCCCTACTGCAT
chr12:104489310-104489329
TACAAATGGGGCAGTTGTTAAAGATGAAAC104489310TTCACTAACAACATTCAGTACCAAATCTGAAGGTTTGAAATGTGTTTCAC
chr14:81126956-81126975
ACCAGATCATTACCTTGTTGAGTGAAAAGC81126956TTCAATGACAACATTGATTACATATGATTTTCAGGTACTATGCTAAGCAC
chr15:97446662-97446682
AATTGAAGTAAGCACATACATAACTGAAAT97446662TTCACTGAGAACAATTGAGTAATATGATTAAACTAAAACAAGATGATCGGT
chr19:41567266-41567284
AAGCCACCACACCCGGCCTATCTTAGCTTT41567266TTCATTGACAACATT-AGTATAATGTTAACAGCTCTCCTAAGGGAGTCAA
chrX:24337849-24337867
AAAGAAAGAAAGAAAAAAAGCAGTTCTAGG24337849TTCACAG-CAACATTGAGTAAAAAGTATAGTTCCCATCCCCCTGCCCCCG
chrX:130867381-130867399
CTCGTAGTATAACTGTTAAAACAAGATTTC130867381TTCACTGATAAC-TTGAGTACTTTTCAAATATAATTATTCATGGAAATAA
chrX:130886148-130886166
CTTGTAGTATATCTGTTAAAACAAGTTTTC130886148TTCACTGAAAAC-TTGAGTACTTTTCAAATATAATTAATTATTCATGGAA
chrX:130892292-130892310
CTTGTAGTATAACAGTTAAAATAAGTTTTC130892292TTCACTGATAAC-TTGAGTACTTCTCAAATAGAATTAATTATTCATGGAA
chrX:130920566-130920584
CCTGTAGTATAATCATTGAAACAAGTTTTC130920566TTCACTGATAAC-TTGAGTACTTTTCAAATGTAATTAATTATTCTTGGAA
chr1:1930393-1930411
TAAATAAATAGCTCATGTTCAAGCACTACA1930393AACTCAATGTTGTCAG-GAAGTCAGTTCCTTCCAGATTGCTCTATAGATT
chr1:155825361-155825379
GTAGATACTCAATGTATCACTGAGTATTGA155825361TACTCAATG-TGTCACTGAATATTGTAGATACTCAATGAATGCTCCCTGA
chr3:49831283-49831301
GCAAAGGTGGTAGGACCACCAGAGGTGTAG49831283TACTCAATGTTGTCA-TGAGGGTAATCCATATCCGTGCCCACCACGGAGC
chr3:185466113-185466131
CTACTAGGTATGCGATATACTGCCTGCCTG185466113TACTCAGTG-TGTCAGTGAACAAGTACTACTGTGTCTTAATATCAGAAGT
chr4:19225840-19225857
TTTTATTATGTGTTTATACCATAGTTTCTT19225840TACTCAA--TTGTCAGTGAACATTTCAGTTCCTTTATCTTGGCTATTTTC
chr4:74112901-74112919
CCAAATGAAAAACAAAGATTAAAAAACTTA74112901TACTCAATGTTGACAGT-AATCAGAAAAATGAAAACAAAACACCATTTTT
chr5:128909692-128909711
AAAATGGCAGCTTTCTATTCATCACACATT128909692TACCCAATGTTGTCAGTGAACAATAATACTTGTTAAGCATCTACTAAGTA
chr5:155592328-155592345
CTTTATGTTCCATCTGCTCTTTAATCTTGC155592328TACTCAATGTTGT--GTGAAATCAAAACTTTTAAAAAATGAAAAAAAAGT
chr6:46475671-46475690
GATCCCTGGCCTATGATAAGCAGGATTTAT46475671TA-TCAATGTTGTCAGTAGAAACTATCCACTAGGTGGGTAACCATATTGTT
chr6:66953409-66953427
GTTTGTTGTTGTTGTTGTTGTTCTTTTTAT66953409TGCTCAATGTTGTCAG-GAAACTATGTTGAACAAACTGATGTTATTGAGG
chr6:76019496-76019513
CCAAATCAGAAACCCAAGAGTCACCCTCTC76019496TACTCAAT-TTGTCA-TGAAATCGTTATGATTCTGTCTTCACTATATCTC
chr6:127178654-127178672
TGTGTTTTATTCTTGGTACATTACATTTGT127178654TACTCAATGTT-TCAGTTAAGTTGAATCTGCTTTATGAAACTTAAAATCC
chr6:134357750-134357771
TTCACCGCTAGCCTTCTGGCACAAAGTAAA134357750TACTCAATGTTTGTCGAGTGAATGAATGAATGAATGAAAACAACACTCCAGA
chr7:88176906-88176924
AACAGAGGACAAAGTTGGAGTCCGCTCCTC88176906TACTCACTGTT-TCAGTGAATGTTGTGCTTTGGTATCCTAGACGAGGTCC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/hg19/2/TTCACTGACAACATTGAGTA
lang : en | db : hg19 | k : 2 | strand : | query_string : TTCACTGACAACATTGAGTA | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.403 | 0.397 | search_plus_done; http://172.18.8.75:44083/match?q=TTCACTGACAACATTGAGTA&k=2&offset=0&limit=50
0.873 | 0.470 | search_minus_done; http://172.18.8.75:44083/match?q=TACTCAATGTTGTCAGTGAA&k=2&offset=0&limit=14
0.890 | 0.017 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).