GGGenome Help | Japanese


Max number of mismatches/gaps: (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2019-02-21 08:44:05, GGGenome : Human genome, GRCh37/hg19 (Feb, 2009)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1:49196-49205
TATGCAGCCATAAAAAAGAACAAGATCATG49196TCTTTGACAGGAACATGGATGGAGCTGGAGGCTACTATCC
chr1:76443-76452
AAATAATGCCGCATATCTACAACTATCTGA76443TCTTTGACAAACCTGAGAAAAACAAGCAATGGGGAAAGGA
chr1:80181-80190
AAATAAAGCCAAATACTTTCAGCCAACTGA80181TCTTTGACAAAGCAAGCAAAAACATAAAGTGGGGAAAGGA
chr1:116870-116879
CCATCTACTTTAAGAGTCTTCATTTATCAT116870TCCTTGACAAACTGTAAATATACATGTTCACTTTTTTATC
chr1:263187-263196
CCATCTACTTTAAGAGTCTTCATTTATCAT263187TCCTTGACAAACTGTAAATATACATGTTCACTTTTTTATC
chr1:606467-606476
TGAATATCCAAAAACCCTCATTTCACTGAA606467TCTTTGACAGACCCCTTTGCATCCTCTTGTTCTTCTAATT
chr1:616421-616430
AAATAACACCACACATCTACAACTATCTGA616421TCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAACGA
chr1:643235-643244
CCATCTACTTTAAGAGTCTTCATTTATCAT643235TCCTTGACAAACTGTAAATATACATGTTCACTTTTTTATC
chr1:746403-746412
AACTAAAATTGCTTATTTGCCGGTCATCGT746403TCTTTGACAAGAAAATTGTATACAAGCCCCTTTCCACTCA
chr1:752242-752251
AAATAAAGCCACACACCTACAACCATCCAA752242TCTTTGACAAGGCCAGCAAAAGCAGCAGTGGAAAAAGACC
chr1:1237368-1237377
GTTCTTCCCCCAGCCCTGGGGGCCACTCAC1237368TCTTTGACAAAGCTCTGGAGCTGCTGCCGCACGGACCTCT
chr1:1848290-1848299
AGGAGAGCGAGCTGAGGGCGGCATTCCGTG1848290TCTTTGACAAAGAGGGCAAGGGCTACATTGACTGGAACAC
chr1:2103269-2103278
CTTGTGGAGGCTGCCACATCGTTCTCTGTG2103269TCTTTGACAGCAGGCCATCCTAAGGCGCATGGGGTGGTGT
chr1:2164142-2164151
AGTCTCCTCTTAGGGACCCTGGGGCTGCTA2164142TCCTTGACAGGGGACCTTGTCTCACCTCCCCACTCGGTCC
chr1:2913681-2913690
GTTTTATTTTTGTCTCTGTCTTTGTCTTTG2913681TCTTTGACAGCTGGACTATGAAGTGTTTAATGTGCATCCC
chr1:3171586-3171595
AAATAACGCCGCATGTCTACAACTATCTGA3171586TCTTTGACAAACCTGAGAAAAACAAGCAATGGGGAAAGGA
chr1:4098891-4098900
GAAAAAAGCTAAATGCTTACAGCCAAATGA4098891TCTTTGACAAAGCAAACAAAAACATAAAGTGGGGAAAGGA
chr1:4163813-4163822
AAATAACGCCACATATCTACAACTATCTAA4163813TCTTTGACAAACCTGAGAAAGATGGGCAATGGGGAAAGGA
chr1:4314633-4314642
AACTGCACAGCTCAATTCTGTTTCCCTCTC4314633TCTTTGACAAGAGTTGCTCCAAAGAACACTTCCCAATAAT
chr1:4326042-4326051
TCACTGCAGGACATGGACCCATGCCCATCT4326042TCTTTGACAAACAGGCTGCTGTTTGGGGACCTACAAATAT
chr1:4452770-4452779
AAACCATCCCACATAAATATAGTCAAGTGA4452770TCTTTGACAAAGGAGCAAAGTTAAAATGACCAAGCAAAGA
chr1:4466690-4466699
GAACAATGTCTTGCCTTTACCAATATCTTA4466690TCTTTGACAAAACGCTTTTCTAGAGTGAGGGGCCTGAGTG
chr1:4696364-4696373
CCGAAAACACCCAATAGAAGGGAAAGAGCT4696364TCCTTGACAAGTGTGGACATCACCTTGTTCTCAAACACCG
chr1:4814557-4814566
TGAGTTTCCAGTCTCTCAGGCAGCCCATCC4814557TCCTTGACAGTCCCAATCTCCATTCCAAGCTTCCCAGACC
chr1:4912315-4912324
AGGGCATGGTATGACTCACAGGGCTTCACC4912315TCCTTGACAATGTGGGAAGTCAGGATGGAAGGAAGGAGGT
chr1:5115630-5115639
GCAGGCAAATACTAACAACCAAGTAAGTGA5115630TCCTTGACAAAGCATGCAAAAACATAAATTGGGGGAAAGG
chr1:5137642-5137651
TCTGTGCTGCTATATGCAAAATCTGTAATT5137642TCCTTGACAATATGGCAGAACATGGTATGGAACCCTCACT
chr1:5247826-5247835
GCAGATAGTTTTGGCATCCTTTCCCTTCCT5247826TCTTTGACAATTGGGACAGAATCCTACTCTGAATGATTAA
chr1:5305202-5305211
GACCCTGGGGGAATCGGCACCTGCCAGTCA5305202TCCTTGACAGCCATCCCCCAGGAAGCCATCTCCCACGCCT
chr1:5347306-5347315
ATTGTACGACACAGAAAGTGTGGCAAAGGC5347306TCTTTGACAACAGAACACATTTTGTGCCTGCAGGACCCCG
chr1:5391572-5391581
CATCTACCCTCCTTCTGTGTCTCCAGATTC5391572TCCTTGACAAGAGGTCAAGGTCGTTGCAGTCAAGCCCATG
chr1:5701579-5701588
AAATAACGCCACACATCTACAACCATCTGA5701579TCTTTGACAAACCTGACAAAAACAAGCAATGGGGAGAGGA
chr1:5884650-5884659
AAATAATGCCGCTTATCTACAACTATCTGA5884650TCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGA
chr1:6031975-6031984
AGCTCACTTATCTGCACTGGTCAAGTTTCC6031975TCCTTGACAGCATAAACAGATTAATAAATCATTTAAATGC
chr1:6034160-6034169
GCAGGAGTTTCACGTGGGTTATGCTGATAC6034160TCCTTGACAGCATCCACTTTTCAATGGGAAATTATAGCAC
chr1:6061955-6061964
TAGACAGGGAAACTGAGGCCAGATGACTCA6061955TCCTTGACAGAGCCGGGATCATGGTGCAGCTCTCTGACTG
chr1:6752981-6752990
ATGAGCCACTGCGCCCAGCCTCTTTTTTTT6752981TCTTTGACAGAGTCTTGCTCTGTTGCCCAGGCTGGAGTCC
chr1:6848309-6848318
AGCCGCTGTCACTCAGCAGGGAAGTCTTAC6848309TCTTTGACAGGCTTAGTGTGGAGACTCATCCTCCCCAACA
chr1:6861364-6861373
TAGTGGCGACCTCTCTAACTGGGCTAAATA6861364TCCTTGACAGCTTTTTATCTGTCCTCTCCAAGTATTTTTA
chr1:7329311-7329320
AAGCATTCTTGATTGTTTTACAAAATCAGT7329311TCCTTGACAGATGTTGGATCAAGGGCTTCAGTTCTTAGCT
chr1:7792262-7792271
TAGGGGGCAGGAACCTGAACCTCTTTTTGA7792262TCTTTGACAAAAAGAGAATTTCTGGTCTTTTATCCGAGAA
chr1:7856145-7856154
CCCCTGTACCCTTGTGAGAGTGCCCCATGG7856145TCTTTGACAGCTTCCATTGTTTTAAGCATGAGACACCCCA
chr1:7956717-7956726
TGTGCCAGATGCTAGACTTTTTTCAATTTT7956717TCTTTGACAATTAGGTTCATCAGAACCTGTATATTGAAAA
chr1:7984269-7984278
GTAGCATATGCAATTATGTACAGCACATAA7984269TCCTTGACAATGACAATAAATGACTATGTTAGTAGTTTAT
chr1:8755196-8755205
AAATAAAGTCATAAACCTACAGCCATCTGA8755196TCTTTGACAATGCTGACAAAAACAAGCAATGGGTAAAGGA
chr1:8951971-8951980
AAGTGCTGAACCTAATAAAGGAGAAGTTTT8951971TCCTTGACAGTGTCAACTGGGGTAGCAATACTTCTGGTTT
chr1:9109850-9109859
AATAGACCCACGTTAAGTCTATTCAACTGA9109850TCCTTGACAAAGGAGCAAAGAGAACGCAATGGAGAAAAGG
chr1:9706509-9706518
CAGTGGCTCAGAACTCTGGCTTACCCAGAA9706509TCTTTGACAAAGAAGAATGAATTTTCAAGAAGTGACAAGA
chr1:9924327-9924336
GGCCCCCAGGCAGAGAAAAAACAAGGAGCT9924327TCCTTGACAAAATGAGCCAAGTCTAGGTCTAGGCGGGGTC
chr1:10209232-10209241
AATTTCATTTAATAAATTGTCCTTTTTTTC10209232TCTTTGACAGTATAACACTGCCTTTAAATTCAGATGTCCC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/hg19/TCYTTGACAR
lang : en | db : hg19 | k : 0 | strand : | query_string : TCYTTGACAR | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.097 | 0.092 | search_plus_done; http://172.18.8.78:28018/match?q=TCTTTGACAA&k=0&offset=0&limit=50 http://172.18.8.78:28018/match?q=TCCTTGACAA&k=0&offset=0&limit=50 http://172.18.8.78:28018/match?q=TCTTTGACAG&k=0&offset=0&limit=50 http://172.18.8.78:28018/match?q=TCCTTGACAG&k=0&offset=0&limit=50
0.135 | 0.038 | search_minus_done; http://172.18.8.78:28018/match?q=TTGTCAAAGA&k=0&offset=0&limit=0 http://172.18.8.78:28018/match?q=CTGTCAAAGA&k=0&offset=0&limit=0 http://172.18.8.78:28018/match?q=TTGTCAAGGA&k=0&offset=0&limit=0 http://172.18.8.78:28018/match?q=CTGTCAAGGA&k=0&offset=0&limit=0
0.135 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).