GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2019-09-21 06:04:32, GGGenome : Human genome, GRCh38/hg38 (Dec, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1:82996793-82996807
CTAATTAATGAATAGTAAGTATATTTTCTC82996793TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
chr2:160366604-160366618
ATTGCAGCAAAGAAGCACATTTATATTCTA160366604TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
chr3:15248283-15248297
ATTGTAATAGCCAGAAATTGGAAACATATA15248283TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
chr3:84570694-84570708
TTGGTTTTGTATATATTAAATAGTTGAAAC84570694TTCATTGACAACATTAAGTTTGTTTTCTAGGCTCTATTGGGATAA
chr4:16133028-16133042
AACGAAAGGCGTTTGAGGAAAGCCTGATAA16133028TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
chr4:62165422-62165436
TCTTCAAATATTTTACAGAGTTCAACTCTT62165422TTCATTGACAACATTATGACATTATGCTGATTGGATCCAGTGAGT
chr4:148912066-148912080
CAGAATATATTATCGCTTTAAACACAGATT148912066TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
chr4:165800998-165801012
AAAAACGTCTGATTTTGTGTAACACTCCTT165800998TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
chr6:61998311-61998325
CTATTTCAATCAACCATCTTGTAATCATAC61998311TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
chr7:3524041-3524055
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC3524041TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
chr8:31498629-31498643
GTATTTTTAAATTCATCGATATTTCCACTT31498629TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
chr11:24472484-24472498
TTGAGTTTCCTGGAACATAGATATGTCTTG24472484TTCATTGACAACATTCTAGCATTGAGGACAGTGAATAGAGAAAAG
chr13:84191412-84191426
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA84191412TTCATTGACAACATTTCCTGAGGTAACTCACACTGAGGTGACAAC
chr18:29571724-29571738
ATATTTATATATGTATATATTTCATATTAT29571724TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
chr19:41061361-41061375
AAGCCACCACACCCGGCCTATCTTAGCTTT41061361TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
chr2:196213136-196213150
AATGCCCCACATTTCATTAAGGGTGATGAC196213136AATGTTGTCAATGAAGAAGTTGCTTCTCATATAACTATACTGTCA
chr3:57200491-57200505
GCCTGTTTTTCATATGCATATGTAATAGGG57200491AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
chr3:97360478-97360492
AATTTGAATATTAATTTTAAAATTTATTCA97360478AATGTTGTCAATGAACATTGTCAGACATTTTGCAGCATTTCTTTA
chr5:9759391-9759405
GAGGGCCTTTCCAGCTCCAAAGTCGATGGC9759391AATGTTGTCAATGAAAGATCAACAGATCAGTGCATTATACCCAGG
chr7:34118949-34118963
TCTACAGATTTTGGATTTACCAGCCCCCAC34118949AATGTTGTCAATGAATTCCTTAAAATCTCTCTCTCTCTCTCTCTC
chr7:78722088-78722102
AACTAACACCCATAAAAGGTATGACTCTTT78722088AATGTTGTCAATGAAGATTTAACATAATATTCTATAACAAATATA
chr12:79107514-79107528
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA79107514AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
chr19:40892287-40892301
CTCCCTTAGGAGAGCTGTTAACATTATACT40892287AATGTTGTCAATGAAAAAGCTAAGATAGGCCAGGCATGGTGGCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/hg38/TTCATTGACAACATT
lang : en | db : hg38 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.196 | 0.191 | search_plus_done; http://172.18.8.78:28017/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.212 | 0.016 | search_minus_done; http://172.18.8.78:28017/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=35
0.219 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).