GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-10-24 12:17:02, GGGenome : Anopheles gambiae genome, AgamP4 (Apr, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

2L dna:chromosome chromosome:AgamP4:2L:1:49364325:1
position: 30115449-30115463
ACGATTACTTATTTGTCTTAAATTGAAGCA30115449TTCATTGACAACATTTAAAGAAAATACTTTTTGTTGTTACTATTT
3R dna:chromosome chromosome:AgamP4:3R:1:53200684:1
position: 45062609-45062623
TCCTCCTTCGCTCTCACACACACACACACC45062609TTCATTGACAACATTGGAAACTACACACATTGAGGAAATTTAAAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : https://gggenome.dbcls.jp/en/AgamP4/AATGTTGTCAATGAA
lang : en | db : AgamP4 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.083 | 0.073 | search_plus_done; http://172.18.8.72:28016/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.004 | search_minus_done; http://172.18.8.72:28016/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.088 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).