GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:35:45, GGGenome : Coelacanth genome, Broad/latCha1 (Aug, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH126922:327960-327974
TGAGGTTTCTGTACCAAAATGCATTAATAA327960TTCATTGACAACATTGGTAATGCAAGGCTTTTAGTGGTAATTTAA
JH127051:293612-293626
CAGTCCCTATTTTGTTTTAAAGGTTTCATA293612TTCATTGACAACATTTGTTGTGCTTTTTCCCCATGAAAGTTTCTG
JH127353:525138-525152
ATATATATATACACACACACATACACTATA525138TTCATTGACAACATTTCTGATATATGATCTTTAGTGAAGAAATAA
JH129181:200991-201005
ATCTAAGTTGGTTCAATAAAAGGTATCACA200991TTCATTGACAACATTTTCCAAAGACCAACACGGCTACAAACATTT
JH126780:629286-629300
CTCATTTGAAGCCACATTTTAAGTGACATG629286AATGTTGTCAATGAAACTTAACCACCCCAACTCTTAGTCCTTCTA
JH127368:139537-139551
GTAAAGAGTAAAGAACTTTCTAGCCAGCAC139537AATGTTGTCAATGAAACCACAGCTAGCGAGCTTCACACGAATGAT
JH127687:446655-446669
GGAGAATGAAGTTTATTAAGAGGGCTTAGT446655AATGTTGTCAATGAAGGAAAATAAAGGTTGATAAATGGAGTTGGG
JH127727:304051-304065
TGATACAAGTCCAAATCATAGAGGTGAATT304051AATGTTGTCAATGAAGGTTAAAATTCTATCCAGACGCACAAATTG
JH130175:2635-2649
GAGTAATTCAAGAGTTTCTACCACAGGCAT2635AATGTTGTCAATGAAAGTACCAAGTGTTTCTTCATATCACCATCC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/latCha1/TTCATTGACAACATT
lang : en | db : latCha1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.072 | search_plus_done; http://172.18.8.76:28073/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.005 | search_minus_done; http://172.18.8.76:28073/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.084 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).