GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-23 01:49:37, GGGenome : Crab-eating macaque pre-spliced RNA, TRaC 21.01 on macFasRKS1912, D3G 21.01 (Jan, 2021)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

TRaC2101L28d16;ENSMFAG00000042405|AC005838.1|chr16:63420483:63563178:-|prespliced::chr16:63420483-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d17;ENSMFAG00000042405|COX10|chr16:63420483:63563178:-|prespliced::chr16:63420483-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d19;ENSMFAG00000042405|AC005838.1|chr16:63421738:63563178:-|prespliced::chr16:63421738-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d1a;ENSMFAG00000042405|COX10|chr16:63421896:63563178:-|prespliced::chr16:63421896-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d1b;ENSMFAG00000042405|AC005838.1|chr16:63422026:63563178:-|prespliced::chr16:63422026-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d1c;ENSMFAG00000042405|AC005838.1|chr16:63422130:63563178:-|prespliced::chr16:63422130-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d1d;ENSMFAG00000042405|COX10|chr16:63422142:63563178:-|prespliced::chr16:63422142-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d1e;ENSMFAG00000042405|COX10|chr16:63423022:63563178:-|prespliced::chr16:63423022-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d1f;ENSMFAG00000042405|AC005838.1|chr16:63423717:63563178:-|prespliced::chr16:63423717-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d22;ENSMFAG00000042405|AC005838.1|chr16:63437920:63563178:-|prespliced::chr16:63437920-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d23;ENSMFAG00000042405|AC005838.1|chr16:63438467:63563178:-|prespliced::chr16:63438467-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d25;ENSMFAG00000042405|COX10|chr16:63455919:63563178:-|prespliced::chr16:63455919-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d26;ENSMFAG00000042405|COX10|chr16:63457685:63563178:-|prespliced::chr16:63457685-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d27;ENSMFAG00000042405|COX10|chr16:63463640:63563178:-|prespliced::chr16:63463640-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d28;ENSMFAG00000042405|COX10|chr16:63471137:63563178:-|prespliced::chr16:63471137-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d2a;ENSMFAG00000042405|COX10|chr16:63506185:63563178:-|prespliced::chr16:63506185-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d2b;ENSMFAG00000042405|COX10|chr16:63526253:63563178:-|prespliced::chr16:63526253-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d2c;ENSMFAG00000042405|COX10|chr16:63529325:63563178:-|prespliced::chr16:63529325-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L28d2d;ENSMFAG00000042405|COX10|chr16:63531160:63563178:-|prespliced::chr16:63531160-63563178(-)
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
TRaC2101L2b74a;na|AL162493.1|chr17:64155009:64421343:+|prespliced::chr17:64155009-64421343(+)
position: 54418-54432
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA54418TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
TRaC2101L31a7e;ENSMFAG00000037028|CYP2B6|chr19:38706073:38841663:+|prespliced::chr19:38706073-38841663(+)
position: 42880-42894
GTGAGCCACCATGCTGGCCTATCTTAGCTT42880TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAA
TRaC2101L31a7d;ENSMFAG00000037028|CYP2B6|chr19:38706073:38842085:+|prespliced::chr19:38706073-38842085(+)
position: 42880-42894
GTGAGCCACCATGCTGGCCTATCTTAGCTT42880TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAA
TRaC2101L4cda8;ENSMFAG00000046933|na|chr5:176195817:177962378:+|prespliced::chr5:176195817-177962378(+)
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
TRaC2101L4cda9;ENSMFAG00000046933|na|chr5:176195817:178390881:+|prespliced::chr5:176195817-178390881(+)
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
TRaC2101L4cdae;ENSMFAG00000046933|na|chr5:176195817:177889327:+|prespliced::chr5:176195817-177889327(+)
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
TRaC2101L4cda1;ENSMFAG00000001427|TENM3|chr5:176195817:178950467:+|prespliced::chr5:176195817-178950467(+)
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
TRaC2101L4cdad;ENSMFAG00000001427|TENM3|chr5:176195817:178948467:+|prespliced::chr5:176195817-178948467(+)
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
TRaC2101L4cdac;ENSMFAG00000001427|TENM3|chr5:176195817:178498271:+|prespliced::chr5:176195817-178498271(+)
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
TRaC2101L4cdab;ENSMFAG00000001427|TENM3|chr5:176195817:178494657:+|prespliced::chr5:176195817-178494657(+)
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
TRaC2101L4cdaa;ENSMFAG00000001427|TENM3|chr5:176195817:178471781:+|prespliced::chr5:176195817-178471781(+)
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
TRaC2101L4d189;ENSMFAG00000041711|F11|chr5:182380896:182408040:+|prespliced::chr5:182380896-182408040(+)
position: 12108-12122
GCCTGAGCCACCATGCCCAGCTTGCTATTC12108TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA
TRaC2101L4d188;ENSMFAG00000041711|F11|chr5:182380896:182407878:+|prespliced::chr5:182380896-182407878(+)
position: 12108-12122
GCCTGAGCCACCATGCCCAGCTTGCTATTC12108TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA
TRaC2101L4d187;ENSMFAG00000041711|F11|chr5:182380896:182401665:+|prespliced::chr5:182380896-182401665(+)
position: 12108-12122
GCCTGAGCCACCATGCCCAGCTTGCTATTC12108TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA
TRaC2101L4d18a;ENSMFAG00000041711|F11|chr5:182380896:182407990:+|prespliced::chr5:182380896-182407990(+)
position: 12108-12122
GCCTGAGCCACCATGCCCAGCTTGCTATTC12108TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA
TRaC2101L4d18b;ENSMFAG00000041711|F11|chr5:182380896:182407990:+|prespliced::chr5:182380896-182407990(+)
position: 12108-12122
GCCTGAGCCACCATGCCCAGCTTGCTATTC12108TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA
TRaC2101L4d18c;ENSMFAG00000041711|F11|chr5:182380900:182408040:+|prespliced::chr5:182380900-182408040(+)
position: 12104-12118
GCCTGAGCCACCATGCCCAGCTTGCTATTC12104TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA
TRaC2101L117c2;ENSMFAG00000003495|SYT1|chr11:75751393:76346690:+|prespliced::chr11:75751393-76346690(+)
position: 245949-245963
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA245949AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117c4;ENSMFAG00000003495|SYT1|chr11:75752425:76347143:+|prespliced::chr11:75752425-76347143(+)
position: 244917-244931
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244917AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117c7;ENSMFAG00000003495|SYT1|chr11:75752425:76105811:+|prespliced::chr11:75752425-76105811(+)
position: 244917-244931
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244917AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117c3;ENSMFAG00000003495|SYT1|chr11:75752425:76344886:+|prespliced::chr11:75752425-76344886(+)
position: 244917-244931
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244917AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117cb;ENSMFAG00000003495|SYT1|chr11:75752425:76180996:+|prespliced::chr11:75752425-76180996(+)
position: 244917-244931
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244917AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117c9;ENSMFAG00000003495|SYT1|chr11:75752425:76346889:+|prespliced::chr11:75752425-76346889(+)
position: 244917-244931
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244917AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117c8;ENSMFAG00000003495|SYT1|chr11:75752425:76188559:+|prespliced::chr11:75752425-76188559(+)
position: 244917-244931
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244917AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117c6;ENSMFAG00000003495|SYT1|chr11:75752425:76344886:+|prespliced::chr11:75752425-76344886(+)
position: 244917-244931
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244917AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117c5;ENSMFAG00000003495|SYT1|chr11:75752425:76346693:+|prespliced::chr11:75752425-76346693(+)
position: 244917-244931
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244917AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117cc;ENSMFAG00000003495|SYT1|chr11:75752441:76346676:+|prespliced::chr11:75752441-76346676(+)
position: 244901-244915
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244901AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117cd;ENSMFAG00000003495|SYT1|chr11:75752441:76188385:+|prespliced::chr11:75752441-76188385(+)
position: 244901-244915
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244901AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117ce;ENSMFAG00000003495|SYT1|chr11:75752441:76106021:+|prespliced::chr11:75752441-76106021(+)
position: 244901-244915
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244901AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117d2;na|SYT1|chr11:75970781:76007718:+|prespliced::chr11:75970781-76007718(+)
position: 26561-26575
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA26561AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
TRaC2101L117d3;na|SYT1|chr11:75974271:76007718:+|prespliced::chr11:75974271-76007718(+)
position: 23071-23085
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA23071AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/macFasRKS1912_Trac2101_prespliced_d3g2101/TTCATTGACAACATT
lang : en | db : macFasRKS1912_Trac2101_prespliced_d3g2101 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.101 | 0.093 | search_plus_done; http://172.18.8.75:28860/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.133 | 0.032 | search_minus_done; http://172.18.8.75:28860/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=14
0.142 | 0.009 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).