GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-01-23 18:11:55, GGGenome : Mouse lemur genome, Mouse lemur/micMur2 (May, 2015)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

KQ052971v1:338293-338307
CATGATAACAATCTGAGTCATGTAGTTGAG338293TTCATTGACAACATTTAAATAATCCATAGCTCTTTTCCACTGTTC
KQ053454v1:2729975-2729989
TTTTTATGATTCTTAAAGGGTCATTTTATA2729975TTCATTGACAACATTTAGAAATGATTTTTGTAACTTTAAAATTAA
KQ055214v1:3991146-3991160
AGAATTTACTTTTTTCTTTATTTTCTTTCT3991146TTCATTGACAACATTTACAAATTAGGAAATTGACCATAAAGTCTA
KQ057204v1:3677392-3677406
CCAATAGGCTTTCGCCCAACAGCTTTAGCT3677392TTCATTGACAACATTTGATTAAATGAATTACAACACTGGGGTTTG
KQ058261v1:654491-654505
TAAATTGAAACAATGCAACGCAGACTCCCA654491TTCATTGACAACATTTAGGTGTCCCTGGTAGTATTCTTTAGTGTA
KQ058538v1:4577915-4577929
TATTTCATCTTTGCCATCTCCAAAGCACTT4577915TTCATTGACAACATTAGCCTAAGATACACAAAGCAAATTAACAAC
KQ052971v1:5794013-5794027
CAGGATAAAGTTGAGATTCAGTAAATATTT5794013AATGTTGTCAATGAAATAATTTCCTTAATCTCTGACCTTTGATTG
KQ053631v1:2536834-2536848
ATACCTGTCTGCTGACAAAATAAATTTCAG2536834AATGTTGTCAATGAATGAACTGCATGTTCTCTACTATATATGGAA
KQ053729v1:2591086-2591100
TGGTGAAATATATAAAACACAGCCAAAGAG2591086AATGTTGTCAATGAATGCAATTCTACCCTTTATTTATTTACTGTT
KQ055014v1:475770-475784
AGGGAAACTTTTCATCCATTTCATCAAAAC475770AATGTTGTCAATGAAAGAGGAGGTTTTGTTTAACCAAATATTTTG
KQ055247v1:5556832-5556846
GCTTTCCAGTATGCTATTAATATATTTAGT5556832AATGTTGTCAATGAAGTCAGAAAAGAGAGCAAAACAGAAACTTGT
KQ055651v1:1387893-1387907
CAACAGGTTTTTCTACCCCCTTATTTTTCA1387893AATGTTGTCAATGAAAACATACAATTTTGTAATTTTGTGATCTAT
KQ056587v1:4950470-4950484
TCCTTAATTGGGTAAAAATAATTAATTTTA4950470AATGTTGTCAATGAAGGCCAATTAATCGTTCTTTTAAACATGTTA
KQ056627v1:54650-54664
CTAAGGGTCTACAATATGGAGCTTACTAGG54650AATGTTGTCAATGAAAGAAATAGTAGGCTTTTTTAGAGATAAATG
KQ056800v1:487537-487551
CAGAACAAACTAAAGGTGTGAAAAATGTAA487537AATGTTGTCAATGAAGTAACTTAATAAATCATACATTTTAGATTT
KQ056800v1:2009810-2009824
TCACAATAGCCAAGCTGTGAAAACAACCTA2009810AATGTTGTCAATGAATAAATAGATAAAGAAAATACGATATAGATA
KQ056855v1:6600650-6600664
TATATGTTTCAGGTTATACTGGACTCTGTT6600650AATGTTGTCAATGAATTGGGAAATTTCTTACTTTGTAAATGTGCT
KQ057755v1:1010397-1010411
GAAATGTCAGAAGCAAAGCAATTTTACTGC1010397AATGTTGTCAATGAAACTTGTTCTTTAATGCAACATTTATTTAGT
KQ058561v1:1127059-1127073
GGCCAAGCACAGGCATCTTGCAGTCTGTAA1127059AATGTTGTCAATGAAAGTCACCAGCTGGGAAAAGCAGTGTGCCCA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/micMur2/TTCATTGACAACATT
lang : en | db : micMur2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.085 | 0.078 | search_plus_done; http://172.18.8.77:28766/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.097 | 0.012 | search_minus_done; http://172.18.8.77:28766/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.099 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).