GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2019-04-23 15:05:45, GGGenome : Platypus genome, WUGSC 5.0.1/ornAna1 (Mar, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Contig11410:6692-6706
CCCAAAGAGCTGACTATTTGTAGATACAAT6692TTCATTGACAACATTTTGATCTTTGAACAGAAAAGAACTCCAAAA
Contig28909:2460-2474
CATTGGGTAGATACAATCAAGGAAACAGAA2460TTCATTGACAACATTCAACTCTGTGTCCTAATTGGTGTTCCTTTT
Ultra305:296194-296208
GCAACTAAATAGAATCGAGGCGATGTACAA296194TTCATTGACAACATTGATAGGGTGAAGAAAATATAAACAAGTGGG
Ultra479:1487358-1487372
TCCTTTCCAGGCATCTGATTTTGTGTATGG1487358TTCATTGACAACATTGGAGGAACTTCAAGAAATTGGATTTGTCTT
Ultra479:1489156-1489170
TCCTTTCCAGGCATCTGATTTTGTGTATGG1489156TTCATTGACAACATTGGAGGAACTTCAAGAAATTGGATTTGTCTT
Ultra5:1285044-1285058
TTTTAAAACTATTTTATGAGGCTATTCATT1285044TTCATTGACAACATTTTAAGTACAAATATGACACAGCCCTATAGG
Contig22:3296920-3296934
GTACAAGGTGAAAAATTTTCTTGCCAGAAC3296920AATGTTGTCAATGAAACCACAGCTGGCCAGCTTCACCCGAATGAT
Contig31203:4376-4390
CTTTTATTCCAAACTTATTTTTGTAAGGGG4376AATGTTGTCAATGAATCATGGCACACATGGTTTGTATATTTGTGG
chr7:10300979-10300993
TAGACTCAAACACAATAAAATCATACTTAT10300979AATGTTGTCAATGAAATTTAAGACACCATTGCAAGTTTCTGCATT
chr12:15581192-15581206
CTGAGGAAGTGATCCAGTTATGAACCCATG15581192AATGTTGTCAATGAATCATGGACTAAAGCAGAGAGACCTAGAATC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ornAna1/TTCATTGACAACATT
lang : en | db : ornAna1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.076 | 0.070 | search_plus_done; http://172.18.8.77:28052/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.009 | search_minus_done; http://172.18.8.77:28052/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.088 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).