GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-03-05 23:10:10, GGGenome : Oxytricha trifallax macronuclear genome

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Contig22561.0
position: 5419-5433
TTGCTTTTCTACCTCAATGATGTCCTCTAC5419TTCATTGACAACATTGTCAAATGTCCACTTGACAAATTTAGCAGC
Contig16902.0
position: 916-930
GCTGCTAAATTTGTCAAGTGGACATTTGAC916AATGTTGTCAATGAAGTAGAGGACATCATTGAGGTAGAAAAGCAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/oxy/TTCATTGACAACATT
lang : en | db : oxy | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.173 | 0.166 | search_plus_done; http://172.18.8.72:28254/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.177 | 0.004 | search_minus_done; http://172.18.8.72:28254/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.178 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).