GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:41:44, GGGenome : Baboon genome, Baylor Panu_2.0/papAnu2 (Mar, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:78112482-78112496
ACTATGCTGCACTCCAAATACTATTGTGTT78112482TTCATTGACAACATTCCCTATTACATATGCATATGAAAAACAGGC
chr5:138932855-138932869
CAGAATATATTATCGCTTTGAACACAGATT138932855TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
chr5:155196760-155196774
TAAAACCTCTGATTTTGTGTAACACTCCTT155196760TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
chr5:170678294-170678308
TTTGGACCCCCAGATCAGTCTTCATATTCT170678294TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAAATAGAATT
chr6:44146969-44146983
TTAAGTCTTATTAACTTAAATTGCTATTAA44146969TTCATTGACAACATTAATAACTGTATAACAAACTATGCAAGCTTT
chr17:46121423-46121437
TGTTCAACATTTTCCCCTCCAATGTATCTT46121423TTCATTGACAACATTCGGATTTATCACATCAATCAGTCAATAAAT
chr17:61655084-61655098
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA61655084TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
chr18:3777882-3777896
AGCTACAGCACTCTACAGTGGACACCCACA3777882TTCATTGACAACATTGTTTCTATAGGAAAACTTACTCTAATTTCA
chr5:15892603-15892617
TCCCACAGCTCTTGGGAAACACAAGATTCA15892603AATGTTGTCAATGAATATTTATCGATATCTACTTTGTTGAGAGAA
chr6:9527617-9527631
GAGGGCCTTTCCAGCTCCAAGGTCAATGGC9527617AATGTTGTCAATGAAAGATCAGCAGGTCAGTGCCTTATACCCAGA
chr11:74523137-74523151
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA74523137AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
chr19:35180181-35180195
ACTCCCTTAGGAGAGCTGTAACATTATACT35180181AATGTTGTCAATGAAAAGCTAAGACAGGCCAGGGGTGGTGGCTCA
chr19:35235297-35235311
CTCCCTTAGGAGAGCTGTTAACATTATACT35235297AATGTTGTCAATGAAAAAACTAAGATAGGCAGAGCGTGGTGGCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/papAnu2/TTCATTGACAACATT
lang : en | db : papAnu2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.78:28023/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.006 | search_minus_done; http://172.18.8.78:28023/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.086 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).